ID: 955028796

View in Genome Browser
Species Human (GRCh38)
Location 3:55196582-55196604
Sequence GTTCTCTTATTGAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955028796_955028797 -6 Left 955028796 3:55196582-55196604 CCTTTTTTTCTCAATAAGAGAAC No data
Right 955028797 3:55196599-55196621 GAGAACTCCAGATTTGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955028796 Original CRISPR GTTCTCTTATTGAGAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr