ID: 955031480

View in Genome Browser
Species Human (GRCh38)
Location 3:55225676-55225698
Sequence AGGGTTTTAGAGATGAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955031475_955031480 1 Left 955031475 3:55225652-55225674 CCTACTCCAAAATGACACGCATA No data
Right 955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG No data
955031478_955031480 -5 Left 955031478 3:55225658-55225680 CCAAAATGACACGCATAGAGGGT No data
Right 955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955031480 Original CRISPR AGGGTTTTAGAGATGAGGTA AGG Intergenic
No off target data available for this crispr