ID: 955032448

View in Genome Browser
Species Human (GRCh38)
Location 3:55233987-55234009
Sequence CTCAGGAGGCTGGTTTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955032440_955032448 12 Left 955032440 3:55233952-55233974 CCTTGAGTGGCTGTTGACAAATG No data
Right 955032448 3:55233987-55234009 CTCAGGAGGCTGGTTTTCAGAGG No data
955032438_955032448 29 Left 955032438 3:55233935-55233957 CCGGGGACTGGGAAAAGCCTTGA No data
Right 955032448 3:55233987-55234009 CTCAGGAGGCTGGTTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955032448 Original CRISPR CTCAGGAGGCTGGTTTTCAG AGG Intergenic
No off target data available for this crispr