ID: 955033862

View in Genome Browser
Species Human (GRCh38)
Location 3:55247612-55247634
Sequence CAAGGTAAAGAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955033862_955033868 6 Left 955033862 3:55247612-55247634 CCTTTCTCCTTCTCTTTACCTTG No data
Right 955033868 3:55247641-55247663 TGGAGAGGATCAAGAAGAACAGG No data
955033862_955033866 -9 Left 955033862 3:55247612-55247634 CCTTTCTCCTTCTCTTTACCTTG No data
Right 955033866 3:55247626-55247648 TTTACCTTGAAAGGATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955033862 Original CRISPR CAAGGTAAAGAGAAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr