ID: 955035480

View in Genome Browser
Species Human (GRCh38)
Location 3:55263185-55263207
Sequence GTGCAAAGACAGATGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955035473_955035480 9 Left 955035473 3:55263153-55263175 CCACATCCCCATTCAGCTCTCCC No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data
955035476_955035480 2 Left 955035476 3:55263160-55263182 CCCATTCAGCTCTCCCATTTGGC No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data
955035474_955035480 3 Left 955035474 3:55263159-55263181 CCCCATTCAGCTCTCCCATTTGG No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data
955035471_955035480 13 Left 955035471 3:55263149-55263171 CCCACCACATCCCCATTCAGCTC No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data
955035472_955035480 12 Left 955035472 3:55263150-55263172 CCACCACATCCCCATTCAGCTCT No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data
955035477_955035480 1 Left 955035477 3:55263161-55263183 CCATTCAGCTCTCCCATTTGGCT No data
Right 955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955035480 Original CRISPR GTGCAAAGACAGATGAATCT TGG Intergenic
No off target data available for this crispr