ID: 955035581

View in Genome Browser
Species Human (GRCh38)
Location 3:55264062-55264084
Sequence AGTTATCTGCAGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955035581_955035587 16 Left 955035581 3:55264062-55264084 CCTGCCATCCTCTGCAGATAACT No data
Right 955035587 3:55264101-55264123 ACAGTTCTTGACCTCTTACTGGG No data
955035581_955035588 25 Left 955035581 3:55264062-55264084 CCTGCCATCCTCTGCAGATAACT No data
Right 955035588 3:55264110-55264132 GACCTCTTACTGGGCTTTTGTGG No data
955035581_955035586 15 Left 955035581 3:55264062-55264084 CCTGCCATCCTCTGCAGATAACT No data
Right 955035586 3:55264100-55264122 GACAGTTCTTGACCTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955035581 Original CRISPR AGTTATCTGCAGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr