ID: 955036074

View in Genome Browser
Species Human (GRCh38)
Location 3:55269306-55269328
Sequence TTGGGTTTTTACAAATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955036069_955036074 5 Left 955036069 3:55269278-55269300 CCTAAGTAAAGTATTTGCACCGG No data
Right 955036074 3:55269306-55269328 TTGGGTTTTTACAAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955036074 Original CRISPR TTGGGTTTTTACAAATCTGC TGG Intergenic
No off target data available for this crispr