ID: 955038443

View in Genome Browser
Species Human (GRCh38)
Location 3:55291785-55291807
Sequence TTGTGATTTGCTGCATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955038443_955038448 24 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG No data
955038443_955038445 5 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038445 3:55291813-55291835 AATGTGCACACAAATCACCTGGG 0: 11
1: 45
2: 141
3: 348
4: 797
955038443_955038446 6 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038446 3:55291814-55291836 ATGTGCACACAAATCACCTGGGG 0: 7
1: 32
2: 119
3: 292
4: 646
955038443_955038449 30 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038449 3:55291838-55291860 TCTTATGATGCTGCAGGTTCAGG No data
955038443_955038444 4 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038444 3:55291812-55291834 CAATGTGCACACAAATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955038443 Original CRISPR TTGTGATTTGCTGCATTATG AGG (reversed) Intergenic
No off target data available for this crispr