ID: 955038448

View in Genome Browser
Species Human (GRCh38)
Location 3:55291832-55291854
Sequence TGGGGATCTTATGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955038443_955038448 24 Left 955038443 3:55291785-55291807 CCTCATAATGCAGCAAATCACAA No data
Right 955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955038448 Original CRISPR TGGGGATCTTATGATGCTGC AGG Intergenic
No off target data available for this crispr