ID: 955040134

View in Genome Browser
Species Human (GRCh38)
Location 3:55308377-55308399
Sequence AGGTTTTCACAAATGAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955040132_955040134 -6 Left 955040132 3:55308360-55308382 CCATCACATGGGGAAACAGGTTT No data
Right 955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG No data
955040125_955040134 8 Left 955040125 3:55308346-55308368 CCCACCTCTAAATACCATCACAT 0: 6
1: 152
2: 889
3: 2147
4: 3876
Right 955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG No data
955040124_955040134 20 Left 955040124 3:55308334-55308356 CCTTGCAAAGTTCCCACCTCTAA No data
Right 955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG No data
955040129_955040134 4 Left 955040129 3:55308350-55308372 CCTCTAAATACCATCACATGGGG No data
Right 955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG No data
955040126_955040134 7 Left 955040126 3:55308347-55308369 CCACCTCTAAATACCATCACATG No data
Right 955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955040134 Original CRISPR AGGTTTTCACAAATGAATTA GGG Intergenic
No off target data available for this crispr