ID: 955042456

View in Genome Browser
Species Human (GRCh38)
Location 3:55331355-55331377
Sequence TTACCTTACCAGTTGTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955042456_955042460 22 Left 955042456 3:55331355-55331377 CCTTACAACAACTGGTAAGGTAA No data
Right 955042460 3:55331400-55331422 ATTCATATATCAACTCCAGGAGG No data
955042456_955042459 19 Left 955042456 3:55331355-55331377 CCTTACAACAACTGGTAAGGTAA No data
Right 955042459 3:55331397-55331419 TTCATTCATATATCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955042456 Original CRISPR TTACCTTACCAGTTGTTGTA AGG (reversed) Intergenic
No off target data available for this crispr