ID: 955042771

View in Genome Browser
Species Human (GRCh38)
Location 3:55333187-55333209
Sequence TCCCCTTTGCCCCACTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955042768_955042771 7 Left 955042768 3:55333157-55333179 CCTTGGGTTCTTGAGGCCAATGT No data
Right 955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG No data
955042767_955042771 8 Left 955042767 3:55333156-55333178 CCCTTGGGTTCTTGAGGCCAATG No data
Right 955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG No data
955042765_955042771 18 Left 955042765 3:55333146-55333168 CCAGCAACATCCCTTGGGTTCTT No data
Right 955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG No data
955042764_955042771 19 Left 955042764 3:55333145-55333167 CCCAGCAACATCCCTTGGGTTCT No data
Right 955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG No data
955042769_955042771 -9 Left 955042769 3:55333173-55333195 CCAATGTCCAAGATTCCCCTTTG No data
Right 955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955042771 Original CRISPR TCCCCTTTGCCCCACTGTCC AGG Intergenic
No off target data available for this crispr