ID: 955043446

View in Genome Browser
Species Human (GRCh38)
Location 3:55337955-55337977
Sequence CACGGCAAAAACTCATAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955043446_955043452 8 Left 955043446 3:55337955-55337977 CCAGCTTATGAGTTTTTGCCGTG No data
Right 955043452 3:55337986-55338008 AGAGGGAGGTAGCAGCGATAAGG No data
955043446_955043450 -6 Left 955043446 3:55337955-55337977 CCAGCTTATGAGTTTTTGCCGTG No data
Right 955043450 3:55337972-55337994 GCCGTGGCTGCAGAAGAGGGAGG No data
955043446_955043449 -9 Left 955043446 3:55337955-55337977 CCAGCTTATGAGTTTTTGCCGTG No data
Right 955043449 3:55337969-55337991 TTTGCCGTGGCTGCAGAAGAGGG No data
955043446_955043448 -10 Left 955043446 3:55337955-55337977 CCAGCTTATGAGTTTTTGCCGTG No data
Right 955043448 3:55337968-55337990 TTTTGCCGTGGCTGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955043446 Original CRISPR CACGGCAAAAACTCATAAGC TGG (reversed) Intergenic
No off target data available for this crispr