ID: 955043904

View in Genome Browser
Species Human (GRCh38)
Location 3:55341934-55341956
Sequence CTGGAGAATGTCACTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955043904_955043908 17 Left 955043904 3:55341934-55341956 CCAGCAACAGTGACATTCTCCAG No data
Right 955043908 3:55341974-55341996 CTTGTGTTTTCCAGTGGTCGTGG No data
955043904_955043907 11 Left 955043904 3:55341934-55341956 CCAGCAACAGTGACATTCTCCAG No data
Right 955043907 3:55341968-55341990 CATAGACTTGTGTTTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955043904 Original CRISPR CTGGAGAATGTCACTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr