ID: 955046590

View in Genome Browser
Species Human (GRCh38)
Location 3:55366834-55366856
Sequence CTGATGTTCTCAAGGACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955046585_955046590 24 Left 955046585 3:55366787-55366809 CCATTAACTTCTAAATGGTGGCT No data
Right 955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955046590 Original CRISPR CTGATGTTCTCAAGGACACT GGG Intergenic
No off target data available for this crispr