ID: 955053165

View in Genome Browser
Species Human (GRCh38)
Location 3:55431878-55431900
Sequence TCTCTTTAGTGTAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955053165_955053170 16 Left 955053165 3:55431878-55431900 CCCCAAATCTTACACTAAAGAGA No data
Right 955053170 3:55431917-55431939 GAGTCTCGATTACCAGTTAGTGG No data
955053165_955053171 17 Left 955053165 3:55431878-55431900 CCCCAAATCTTACACTAAAGAGA No data
Right 955053171 3:55431918-55431940 AGTCTCGATTACCAGTTAGTGGG No data
955053165_955053169 -9 Left 955053165 3:55431878-55431900 CCCCAAATCTTACACTAAAGAGA No data
Right 955053169 3:55431892-55431914 CTAAAGAGATATATCTTTGGTGG No data
955053165_955053173 22 Left 955053165 3:55431878-55431900 CCCCAAATCTTACACTAAAGAGA No data
Right 955053173 3:55431923-55431945 CGATTACCAGTTAGTGGGCTGGG No data
955053165_955053172 21 Left 955053165 3:55431878-55431900 CCCCAAATCTTACACTAAAGAGA No data
Right 955053172 3:55431922-55431944 TCGATTACCAGTTAGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955053165 Original CRISPR TCTCTTTAGTGTAAGATTTG GGG (reversed) Intergenic
No off target data available for this crispr