ID: 955055322

View in Genome Browser
Species Human (GRCh38)
Location 3:55449719-55449741
Sequence TGGGATTGCATGTGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955055322_955055326 29 Left 955055322 3:55449719-55449741 CCTGCTCTTCACATGCAATCCCA No data
Right 955055326 3:55449771-55449793 TTATTTCTAATTCTACAGATGGG No data
955055322_955055325 28 Left 955055322 3:55449719-55449741 CCTGCTCTTCACATGCAATCCCA No data
Right 955055325 3:55449770-55449792 GTTATTTCTAATTCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955055322 Original CRISPR TGGGATTGCATGTGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr