ID: 955055325

View in Genome Browser
Species Human (GRCh38)
Location 3:55449770-55449792
Sequence GTTATTTCTAATTCTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955055324_955055325 8 Left 955055324 3:55449739-55449761 CCATATTTGTTCTTTAATCTCGT No data
Right 955055325 3:55449770-55449792 GTTATTTCTAATTCTACAGATGG No data
955055322_955055325 28 Left 955055322 3:55449719-55449741 CCTGCTCTTCACATGCAATCCCA No data
Right 955055325 3:55449770-55449792 GTTATTTCTAATTCTACAGATGG No data
955055323_955055325 9 Left 955055323 3:55449738-55449760 CCCATATTTGTTCTTTAATCTCG No data
Right 955055325 3:55449770-55449792 GTTATTTCTAATTCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955055325 Original CRISPR GTTATTTCTAATTCTACAGA TGG Intergenic
No off target data available for this crispr