ID: 955055326

View in Genome Browser
Species Human (GRCh38)
Location 3:55449771-55449793
Sequence TTATTTCTAATTCTACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955055322_955055326 29 Left 955055322 3:55449719-55449741 CCTGCTCTTCACATGCAATCCCA No data
Right 955055326 3:55449771-55449793 TTATTTCTAATTCTACAGATGGG No data
955055324_955055326 9 Left 955055324 3:55449739-55449761 CCATATTTGTTCTTTAATCTCGT No data
Right 955055326 3:55449771-55449793 TTATTTCTAATTCTACAGATGGG No data
955055323_955055326 10 Left 955055323 3:55449738-55449760 CCCATATTTGTTCTTTAATCTCG No data
Right 955055326 3:55449771-55449793 TTATTTCTAATTCTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955055326 Original CRISPR TTATTTCTAATTCTACAGAT GGG Intergenic
No off target data available for this crispr