ID: 955057545

View in Genome Browser
Species Human (GRCh38)
Location 3:55470178-55470200
Sequence CCGTCTGCACGGTCTTGAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955057542_955057545 3 Left 955057542 3:55470152-55470174 CCAGTGGAACTTGCAGTGGCAGC 0: 2
1: 1
2: 0
3: 13
4: 171
Right 955057545 3:55470178-55470200 CCGTCTGCACGGTCTTGAACTGG 0: 1
1: 0
2: 0
3: 3
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955057545 Original CRISPR CCGTCTGCACGGTCTTGAAC TGG Exonic
902894507 1:19469646-19469668 CTCTCTGCACCTTCTTGAACCGG - Intronic
902916589 1:19643753-19643775 CCAACAGCACGGACTTGAACCGG + Intronic
1070564666 10:77594541-77594563 CAGTCTCCACGGTTCTGAACTGG + Intronic
1077059367 11:611061-611083 CCTTCTGCACGGCCTTGCGCAGG - Exonic
1085955551 11:81389269-81389291 CCTTCTGCACAGTCCTAAACTGG - Intergenic
1091565660 12:1646144-1646166 CCACCTGCACGCTCTTGAACTGG - Exonic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1102512704 12:113426283-113426305 CCATCTGTACGTTCTTGAAAGGG - Intronic
1134189344 16:12109245-12109267 CTCTCTGCAGGGTCCTGAACTGG + Intronic
1136275498 16:29177204-29177226 CCATCTTCATGGTGTTGAACAGG - Intergenic
1142079857 16:88143269-88143291 CCATCTTCATGGTGTTGAACAGG - Intergenic
1143508719 17:7383825-7383847 GCGTCTGCACGGCCTTGTACTGG + Exonic
1143572407 17:7767974-7767996 CCGTCTGCAGGATCAGGAACCGG - Exonic
1153822392 18:8843413-8843435 CAGGCTGCACGTTGTTGAACTGG + Intergenic
1165427193 19:35752747-35752769 CCCTCTGCAGGGTTTTGCACAGG + Intronic
926803470 2:16683151-16683173 CCTTCTGTACGGGCTTGGACTGG - Intergenic
933300275 2:80532981-80533003 CTGTTTACAAGGTCTTGAACGGG + Intronic
945024550 2:205607423-205607445 CTGTCTGCCTGGGCTTGAACTGG + Intronic
947419740 2:229931431-229931453 CAGTCTGCAAGCTCTTGACCTGG + Intronic
948198735 2:236114192-236114214 CCGGCTGCCTGCTCTTGAACTGG + Intronic
1172358421 20:34295433-34295455 CCGTCTCCACGGTCATGTGCAGG + Exonic
1184942538 22:47779736-47779758 GCGTCTGCACAGTCCTGACCAGG - Intergenic
954179880 3:48873308-48873330 CCGCCAGTCCGGTCTTGAACTGG - Intronic
954302158 3:49705772-49705794 TCCCATGCACGGTCTTGAACAGG - Intronic
955057545 3:55470178-55470200 CCGTCTGCACGGTCTTGAACTGG + Exonic
960968831 3:123124616-123124638 CCGTCTCCACGGGTTGGAACTGG + Intronic
975381508 4:73705562-73705584 CCACCTGCACTGTCTTGAACTGG + Intergenic
996546693 5:124686562-124686584 CTGTGTGCACTGTCTGGAACTGG + Intronic
1024096214 7:45984880-45984902 GTTTCTGCACTGTCTTGAACAGG + Intergenic
1049674531 8:143883804-143883826 CCGGCTGCCCGGTCTTGGTCCGG - Intergenic
1056379740 9:86046549-86046571 TCCTCTGCAGGGTCTTTAACTGG + Exonic
1195884773 X:109626403-109626425 TGGACTGAACGGTCTTGAACAGG - Intronic