ID: 955058036

View in Genome Browser
Species Human (GRCh38)
Location 3:55473699-55473721
Sequence GTAGCAGGCCTGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955058036_955058043 1 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058043 3:55473723-55473745 TAATGACATAAAGAGAGGCAGGG 0: 1
1: 0
2: 0
3: 30
4: 392
955058036_955058044 12 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058044 3:55473734-55473756 AGAGAGGCAGGGAGAAAGAAAGG 0: 1
1: 4
2: 142
3: 1533
4: 10383
955058036_955058042 0 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058042 3:55473722-55473744 CTAATGACATAAAGAGAGGCAGG 0: 1
1: 0
2: 2
3: 7
4: 219
955058036_955058040 -4 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058040 3:55473718-55473740 CTACCTAATGACATAAAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 156
955058036_955058046 16 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058046 3:55473738-55473760 AGGCAGGGAGAAAGAAAGGAGGG 0: 2
1: 17
2: 413
3: 5324
4: 52372
955058036_955058045 15 Left 955058036 3:55473699-55473721 CCTCCATCCATCAGGCCTGCTAC 0: 1
1: 0
2: 3
3: 15
4: 180
Right 955058045 3:55473737-55473759 GAGGCAGGGAGAAAGAAAGGAGG 0: 1
1: 5
2: 53
3: 524
4: 3710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955058036 Original CRISPR GTAGCAGGCCTGATGGATGG AGG (reversed) Intronic
900411472 1:2514600-2514622 GTAGGAGGCCTGGTGCAGGGTGG + Intronic
900498142 1:2985901-2985923 GTGGATGGACTGATGGATGGCGG - Intergenic
901473899 1:9475871-9475893 CTAGCAGCCCCTATGGATGGGGG + Intergenic
901910905 1:12457192-12457214 GCAGCATGGCTGAAGGATGGTGG - Intronic
903330047 1:22592677-22592699 GGAGGAGGCCTGAGGGCTGGAGG + Intronic
904235327 1:29112596-29112618 GTAAGAGGCCTGTGGGATGGAGG + Intronic
905412011 1:37777101-37777123 GGTCCAGGCCTCATGGATGGAGG - Intergenic
905896094 1:41546728-41546750 GCACCAGGCCTGATGCAGGGAGG - Intronic
907299619 1:53478412-53478434 GTAGCTAGTCTGAGGGATGGTGG - Intergenic
909686136 1:78351094-78351116 TTAGCAGTCCTCATGCATGGTGG - Intronic
911632346 1:100197393-100197415 GGAGCAGGTCTGATGGTGGGGGG + Intronic
915201692 1:154234624-154234646 GTCTCAGGCCAGAAGGATGGTGG + Exonic
915508527 1:156372631-156372653 GAGGCAGGCGGGATGGATGGTGG + Intronic
918151244 1:181799545-181799567 GTGACAGGCCTCAAGGATGGGGG - Intronic
921620571 1:217321975-217321997 ATACCAAGCCTGATGGATGGGGG + Intergenic
921812588 1:219531437-219531459 GGAGCAGGACGGATGGCTGGGGG - Intergenic
922403177 1:225282304-225282326 GAATCAGGCCTGATGGCTGGGGG - Intronic
1074175418 10:110996138-110996160 GTAGCTAGCTTGATGGGTGGAGG + Intronic
1074666089 10:115726997-115727019 GTATTAGGCCTGCAGGATGGAGG + Intronic
1075621353 10:123930254-123930276 GAAGCAGGGCTGTGGGATGGAGG - Intronic
1075810664 10:125222500-125222522 ATTGCAGGCCTGGTGCATGGTGG + Intergenic
1076273177 10:129174528-129174550 GCAGCAGGCCTGGGGGTTGGGGG - Intergenic
1076628780 10:131840127-131840149 GTGGAGGGCCTGATTGATGGAGG - Intergenic
1079392492 11:20034774-20034796 GTGACAGGCTTGATGGCTGGTGG + Intronic
1083629654 11:64089066-64089088 GCAGCAGGCCGGAGGGAGGGAGG - Intronic
1083813932 11:65121499-65121521 GTAGCAGGCCGCATGCTTGGAGG - Exonic
1084275678 11:68049889-68049911 GGAGCAGGCCTGGCGGGTGGTGG + Intronic
1084600652 11:70143461-70143483 GCAGCTAACCTGATGGATGGAGG + Intronic
1086072197 11:82811710-82811732 TGAGCAGGCCTGAGTGATGGTGG - Intergenic
1089181005 11:116582806-116582828 CTGGCAGGCCTGGTGGAGGGTGG + Intergenic
1089812325 11:121142286-121142308 GCAACAGGCTTGATGGATGGAGG - Intronic
1089851176 11:121497936-121497958 GTAGCAGGCCAGGTGGAAGTAGG + Intronic
1090827867 11:130400566-130400588 GGAGCAGGAAAGATGGATGGGGG + Intergenic
1091489034 12:916923-916945 CTAGAAGGCGTGATGGATGGAGG - Intronic
1095416283 12:41980563-41980585 ATAGCAGGCCTGTTAGATGTGGG - Intergenic
1096255403 12:50059140-50059162 GGAGCAGGGCTGAGGGAGGGTGG - Intronic
1096651582 12:53064534-53064556 GGAACAGGACTGCTGGATGGGGG - Exonic
1096654203 12:53078641-53078663 GTAGCAGCGCCGATGGATGGGGG + Intronic
1100476324 12:94938976-94938998 CTAGCAGGCCTGCTGCTTGGTGG - Intronic
1100596390 12:96076055-96076077 GTAGCAGGACAAATGGATGAAGG - Intergenic
1101286084 12:103314154-103314176 AGAGCAGCCCAGATGGATGGAGG + Intronic
1101711662 12:107273036-107273058 GCACCAGGTCTGTTGGATGGTGG - Intergenic
1101996639 12:109530259-109530281 GAAGCAGGCCTGAGGACTGGGGG + Intronic
1102546990 12:113664410-113664432 GGAGCAGGCCTGGGGGTTGGGGG + Intergenic
1103613550 12:122138370-122138392 GTGGCAGGCCTGCTGGCTGTGGG + Intronic
1104654547 12:130564101-130564123 ACAGCAGGCCTGAAGGGTGGGGG - Intronic
1104895331 12:132161085-132161107 GGAGCAGGCCTGGTGGGAGGCGG - Intergenic
1106285963 13:28318251-28318273 GTGACAGGCCTGAGGGAAGGGGG + Intronic
1106419245 13:29572048-29572070 GAAGCAGGCCTGATGGCCAGTGG + Intronic
1109788205 13:67210523-67210545 GAAGTAGGCCAGATGGATGTTGG + Intronic
1114770649 14:25426397-25426419 GTAGCAGGCCAGATTGATTTAGG + Intergenic
1116148355 14:41104159-41104181 GCAGAAGGTCTGATGGATGTAGG + Intergenic
1118990974 14:70796714-70796736 GTCACAGGCCTGAAGGATGAGGG - Intronic
1122341723 14:101032985-101033007 CTGGAAGGCCTGATGGATGGTGG + Intergenic
1128523672 15:68392439-68392461 GTAGAAGTCTTGCTGGATGGAGG + Intronic
1130533043 15:84762285-84762307 GAAGCAGGCTTGGTGGATGAGGG + Intronic
1130770953 15:86923051-86923073 GTATCCGGCCCGAGGGATGGTGG + Intronic
1132850227 16:2021729-2021751 GGAGGGGGCCTGGTGGATGGAGG - Intergenic
1135913033 16:26578636-26578658 GTGGCAAGGCTGATGAATGGAGG + Intergenic
1137716351 16:50600760-50600782 GTCTCAGGCCTGAGGGCTGGAGG + Intronic
1137723696 16:50642736-50642758 GGTGCAGTCCTGATGGATGAAGG + Intergenic
1139280212 16:65764167-65764189 GCAGAAGGAGTGATGGATGGAGG + Intergenic
1139386395 16:66575047-66575069 GTAGCAGGGCTGGTGGAGGTTGG - Intronic
1141482884 16:84318508-84318530 GAAGAAGGGCTGATGGCTGGGGG + Intronic
1142390939 16:89799343-89799365 GTAGAAGTCTTGATGGATGTGGG - Intronic
1143001002 17:3794991-3795013 TGAGCAGGCCTGCTGGGTGGAGG - Intronic
1143150699 17:4806645-4806667 GTAAAAGGCCTGAGGGGTGGTGG - Intergenic
1143314280 17:6020093-6020115 GAAGGAGGCATGAAGGATGGTGG + Intronic
1143601497 17:7949078-7949100 GTAGCAGGACTGATGGCCGAGGG + Exonic
1144557979 17:16298601-16298623 GTCCCAGTCCTGATGGAGGGAGG + Intronic
1146974575 17:37099618-37099640 GCAGGAGGGCTGATGGAGGGAGG + Intronic
1146974585 17:37099648-37099670 GGAGGAGGGCTGATGGAGGGAGG + Intronic
1146974598 17:37099693-37099715 GGAGGAGGGCTGAGGGATGGAGG + Intronic
1147747863 17:42706570-42706592 GTCCCAGGCTTGATGGATGTAGG + Intronic
1148217407 17:45840547-45840569 ATTCCAGGGCTGATGGATGGGGG + Intergenic
1149288178 17:55189127-55189149 GCAGAAGGCCTGATGCAAGGGGG + Intergenic
1150235639 17:63590740-63590762 GTAGCAGGCCTGAAGGATGATGG + Exonic
1151877872 17:76877544-76877566 CTCTCAGGCTTGATGGATGGGGG + Intronic
1152495456 17:80668140-80668162 GTAGCAGGCCTGAGGGGTAGCGG + Intronic
1152655140 17:81515729-81515751 GTAGCCGGCCAGGTGGTTGGCGG - Intronic
1153553412 18:6285247-6285269 GTGGCAGCACTGAAGGATGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156446387 18:37240139-37240161 GCAGCAGTCCTGGAGGATGGAGG + Intergenic
1157596235 18:48865536-48865558 GTTCCAGGAGTGATGGATGGCGG - Intergenic
1159938840 18:74390077-74390099 GTAGCAGGCCGCATGCTTGGAGG - Intergenic
1160186490 18:76680325-76680347 GAAGCAGGCATGATGCATGAGGG + Intergenic
1161300996 19:3543269-3543291 GTGGCCTGCCTGATGGCTGGTGG - Exonic
1161626074 19:5327582-5327604 GAGCCAGGCCTGATGGATGTTGG - Intronic
1162568448 19:11457228-11457250 GCTGCAGGCCTGTTGGGTGGGGG - Intronic
1163074846 19:14880730-14880752 GCAGCAGGGCTGCTGGCTGGTGG - Exonic
1165786165 19:38463286-38463308 GGAGCAGGGCTGCTGGATGGTGG + Intronic
1166560839 19:43731479-43731501 GCAGCAGGCCTGATGGATGAGGG - Exonic
927864848 2:26581786-26581808 CTAGCAGGCCTGTTGGAATGAGG + Intronic
932213758 2:69952981-69953003 GCAGAAGGCCTGATGGAGGGAGG - Intergenic
937124082 2:119462147-119462169 GCTGCAGGCCTGATGGAGGAAGG - Intronic
939758716 2:146147636-146147658 GAAGCAGTCATGATGGATAGGGG - Intergenic
942315562 2:174693616-174693638 GCAGCAGCCCTGATGGATGGGGG + Intergenic
944676349 2:202036092-202036114 GTAGCAGGCCAGGACGATGGTGG - Exonic
946427941 2:219609276-219609298 GCAGCAGGCCTGAGGGCCGGGGG + Intronic
948293151 2:236842219-236842241 TTTGCAGGTCTGAGGGATGGCGG + Intergenic
1169267218 20:4174102-4174124 ATAGCAGGCTTGTTGGATGCAGG + Intronic
1169560696 20:6797786-6797808 TTAGGAGGCCTGCTGGATGAAGG + Intergenic
1172009281 20:31837056-31837078 GGAGCTGCCCTGATGGAGGGCGG + Intergenic
1172881541 20:38203007-38203029 GAAGCAGAACTGATGGGTGGAGG + Intergenic
1173686863 20:44930141-44930163 GCAGCAGGCCTCATAGATGGGGG + Intronic
1176115669 20:63430935-63430957 AGAGCAGGAATGATGGATGGGGG - Intronic
1176514906 21:7776831-7776853 GAAGCAGTCATGATGAATGGAGG - Intergenic
1177517468 21:22174426-22174448 GGAGCAGGCATGATACATGGTGG - Intergenic
1178397261 21:32253395-32253417 GGAGCAGGCCTAATGGGGGGTGG - Intergenic
1178648961 21:34406890-34406912 GAAGCAGTCATGATGAATGGAGG - Intronic
1179021117 21:37641995-37642017 GCAACAGGACGGATGGATGGTGG + Intronic
1179926879 21:44539599-44539621 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179926915 21:44539851-44539873 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179928422 21:44551159-44551181 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179929584 21:44558416-44558438 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179931544 21:44574066-44574088 GCAGCAGGCCTGCTGGCAGGGGG - Exonic
1179931600 21:44574423-44574445 GCAGCAGGCCTGCTGGCAGGAGG - Exonic
1179932592 21:44580060-44580082 GTAGCAGGACTGCTGGCAGGGGG + Exonic
1179932628 21:44580312-44580334 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179934153 21:44591798-44591820 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179934208 21:44592155-44592177 GCAGCAGGCCTGCTGGCAGGGGG + Exonic
1179935424 21:44600929-44600951 GCAGCAGGCCTGCTGGCAGGGGG - Exonic
1179939224 21:44627449-44627471 GCAGCAGGCCTGCTGGCAGGGGG - Exonic
1179942104 21:44647003-44647025 GCAGCAGGCCTGCTGGTAGGAGG - Exonic
1179948660 21:44697494-44697516 GCAGCAGGCCTGCTGGCAGGGGG - Exonic
1181038754 22:20182145-20182167 GTATCAGGCCGGAAGGGTGGTGG + Intergenic
1181548262 22:23617801-23617823 GGAGCAGGCATGAGGCATGGAGG + Intronic
1181985878 22:26799524-26799546 GCAGAAGGCCTGGTGCATGGTGG + Intergenic
1182305613 22:29365812-29365834 GGAGCTGGCCAGATCGATGGGGG - Intronic
1182312887 22:29421750-29421772 GGAGCTGGCCAGATCGATGGGGG - Intronic
1183746340 22:39694147-39694169 AGAGCCGGGCTGATGGATGGGGG + Intergenic
1184776992 22:46628231-46628253 GGAGCAGGACAGACGGATGGCGG - Intronic
1184818816 22:46893341-46893363 GAGGCAGGCGGGATGGATGGAGG + Intronic
1185001959 22:48251700-48251722 GTGGCAGGGCTGAGGGCTGGAGG - Intergenic
950053215 3:10007615-10007637 GCAGCAGCCCTGAGGGATGGAGG + Intronic
950140101 3:10609402-10609424 GTAGCAGGGCTGATCGATGCCGG - Intronic
950304868 3:11909930-11909952 GGAGCAGCCCCGAGGGATGGAGG + Intergenic
950416609 3:12872585-12872607 GCAGCAGCCCCGAGGGATGGAGG + Intergenic
951746489 3:25983650-25983672 GTAGCTGGCTTGTTGGATTGTGG + Intergenic
952114254 3:30160013-30160035 ATAGCAGGCCACATAGATGGTGG + Intergenic
955058036 3:55473699-55473721 GTAGCAGGCCTGATGGATGGAGG - Intronic
955087009 3:55712600-55712622 GTAGCCATCCTGGTGGATGGTGG + Intronic
956668631 3:71665074-71665096 GAGGCAGCCCTGATGCATGGTGG + Intergenic
965222158 3:165940010-165940032 GTAGAAGCACTTATGGATGGTGG + Intergenic
969694245 4:8725758-8725780 GGAGGAGGCCTGCTGGCTGGTGG - Intergenic
970446066 4:16124256-16124278 GTAGCAGGTTTGAAAGATGGAGG + Intergenic
976044717 4:80931378-80931400 GTGGGAGGCATGATGGATGATGG + Intronic
977148788 4:93481871-93481893 ATTGCAGGCTTGATGGAGGGAGG + Intronic
987313099 5:16699374-16699396 TTATCCGGGCTGATGGATGGCGG - Intronic
997528188 5:134566834-134566856 GTCACAGGCCTGGTGAATGGTGG + Intronic
997896909 5:137727112-137727134 GTAGCAGGCTTAAGGGAGGGTGG - Intronic
999461060 5:151758154-151758176 GGAGCTGGCCTGAAGGAGGGCGG - Intronic
999486647 5:152003880-152003902 GGAGAAGGCATGATGGATTGCGG + Intergenic
1000535332 5:162471648-162471670 ATGTCATGCCTGATGGATGGTGG + Intergenic
1002616316 5:180458623-180458645 GGAGCAATCCTGATGGATGAGGG - Intergenic
1005030934 6:21508471-21508493 GGAGAAGGGCTGAAGGATGGAGG - Intergenic
1011432221 6:87299957-87299979 GTAGCAGTGCTGAAGGCTGGTGG + Intronic
1015572477 6:134635955-134635977 GTAGAGGGCCTGAGAGATGGTGG - Intergenic
1016148276 6:140703446-140703468 GAAGCAGTCCTGATGAATGAGGG + Intergenic
1017034178 6:150252238-150252260 GGAGGAGGCCTTGTGGATGGAGG + Intergenic
1017503761 6:155048606-155048628 GTGGCAGGCCTGGTGGCTCGAGG + Intronic
1018849657 6:167577925-167577947 GTGGCAGTGCTGATGGCTGGAGG - Intergenic
1018851195 6:167591326-167591348 GTAGTGGTCATGATGGATGGTGG - Intergenic
1018854541 6:167666237-167666259 GTAGCTGGCCTCATGGAGGGTGG + Intergenic
1019364731 7:627558-627580 CTTGCAGTCCTGATGGATTGGGG - Intronic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1019655979 7:2196035-2196057 GTGGCCAGCCAGATGGATGGAGG + Intronic
1024767776 7:52681346-52681368 GTAGCAGGCTTGATGGTGTGGGG + Intergenic
1029623134 7:101702363-101702385 GCAGCAAGACTGAGGGATGGGGG + Intergenic
1032198858 7:129805167-129805189 GGGGCAGGCCTGCGGGATGGGGG + Intergenic
1033780868 7:144667563-144667585 TGAGCATGCCTGATGGATGGAGG + Intronic
1034232173 7:149539042-149539064 GTAAGAGGACTGATGGCTGGGGG - Intergenic
1036045777 8:5138497-5138519 ATATCAGGCCTGAGGCATGGAGG + Intergenic
1038842461 8:31197773-31197795 GTTGCCGGCGTGAGGGATGGGGG - Intergenic
1041870433 8:62627957-62627979 GAAGAAGGCCTGTTGGATGAAGG - Intronic
1047177190 8:122553106-122553128 ATAGGAGGCCTAATGGATAGGGG + Intergenic
1047360967 8:124169150-124169172 GTAGCTGGCCTTGTGGATGCAGG - Intergenic
1049014918 8:139913581-139913603 GCAGCAGGCCTGTTGGAGGCAGG - Intronic
1049289200 8:141792489-141792511 GTGTCAGGCCTGTGGGATGGTGG + Intergenic
1049674959 8:143885253-143885275 GCAGCAGGCCTGGGGGACGGAGG + Intergenic
1049750216 8:144279512-144279534 AAACCAGGCCTGATAGATGGGGG - Intronic
1051571764 9:18566746-18566768 GTGACAGGCCTGAGGGATGATGG + Intronic
1054938389 9:70713558-70713580 AGAGCAGGCCTGGTGGATGTTGG - Intronic
1054940080 9:70731551-70731573 AGAGCAGGCCTGGTGGATGTTGG - Intronic
1058842768 9:108925986-108926008 GTAGCTGGCCTGATTGAAGAGGG - Intronic
1059202520 9:112431227-112431249 GCAGCAGGCCTGGTGAATGAGGG + Intronic
1061050199 9:128190897-128190919 GGAGCAGGCCTGACTTATGGTGG - Intronic
1061128906 9:128695887-128695909 GCACCAGGTCTGTTGGATGGTGG - Exonic
1061152236 9:128835509-128835531 GTAGCTGCCCTGAGGGATGATGG + Exonic
1062523323 9:136968600-136968622 TGAGCAGGCCTGAGGGAGGGTGG + Intergenic
1187254450 X:17629599-17629621 GCATCAGGCCTGGTGGATGGAGG + Intronic
1189210950 X:39281692-39281714 GTTGAAGGCCTGATGGTTGCAGG - Intergenic
1193168070 X:78304288-78304310 TTAGAAGGCCTGAAGAATGGTGG - Intronic
1193265524 X:79464064-79464086 GTAGCAGCTCTTATGGGTGGGGG - Intergenic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1193700709 X:84757215-84757237 GCACCAGGTCTGTTGGATGGTGG - Intergenic
1194450332 X:94038001-94038023 GAAGCAATCATGATGGATGGAGG + Intergenic
1197726347 X:129779475-129779497 GCTGCAGGCCTGATGGCTGTAGG + Intergenic
1198707577 X:139465410-139465432 GATGCAGGCCTGAGGGCTGGAGG + Intergenic