ID: 955058158

View in Genome Browser
Species Human (GRCh38)
Location 3:55474342-55474364
Sequence GGCCGGCCTCGTTGTTGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955058158 Original CRISPR GGCCGGCCTCGTTGTTGTGC AGG Exonic
900154179 1:1197517-1197539 GGTCGGCCTCACCGTTGTGCAGG - Exonic
900896590 1:5487111-5487133 GTCCTGCCTGGTTGTTCTGCTGG - Intergenic
903259007 1:22121216-22121238 TGCCGGCCTCATTGTTGTGGAGG + Exonic
906291061 1:44619408-44619430 GGCCGGCCTCGGTGTTTGGTTGG + Intronic
908113229 1:60917461-60917483 GCCCGGCATCATTGTTGTACTGG + Intronic
914675861 1:149906785-149906807 GGCAGCCCTCCTTGTTGTGCAGG + Exonic
914784150 1:150813185-150813207 GGCTGGCCAGGTTGCTGTGCTGG + Exonic
920324073 1:205147788-205147810 GTCATGCCTCTTTGTTGTGCTGG - Intronic
922747169 1:228050894-228050916 GCCCAGCCTCGTTGTTGTGGCGG - Exonic
1064941036 10:20735705-20735727 GGCCTGCTTCTTTGCTGTGCAGG - Intergenic
1068341953 10:55715844-55715866 TGCCGGCCTGATTGTTGTGTGGG - Intergenic
1072806049 10:98424637-98424659 GGCTGGCCTGGTTGCTGTGACGG - Intronic
1073025100 10:100482027-100482049 GGCCAGCCTCGTTGTTGTGCAGG - Exonic
1083322276 11:61855108-61855130 GGCTGGCCACGCTGTTGTGGGGG - Intronic
1091564744 12:1639949-1639971 GACCGGCCTCGTTGTTTTGCAGG - Exonic
1096103011 12:48980662-48980684 GGCCTGCCTCGTTGTTGTGAAGG - Exonic
1112456196 13:99565941-99565963 GGGCGGCCTTCTTGATGTGCGGG - Intergenic
1113610954 13:111644904-111644926 GGCTGGCATCCTTGATGTGCCGG + Intronic
1134803932 16:17108839-17108861 GGCTGGACTCGTTGGTGGGCGGG - Exonic
1142268288 16:89075478-89075500 TGCTGGGCTCATTGTTGTGCTGG + Intergenic
1151804834 17:76398864-76398886 GGCAGAACTCGTTGTTGTCCAGG + Exonic
1162348705 19:10136192-10136214 GGCCAGCCCAGTGGTTGTGCCGG + Exonic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1165229937 19:34380655-34380677 GCCTGGCCTCGAGGTTGTGCAGG + Intronic
925738714 2:6986439-6986461 GGCCTGCCCCCTTGTTGAGCTGG + Intronic
926045049 2:9704070-9704092 GGCCTGCCTTGCTGTTGTGGGGG + Intergenic
937085672 2:119170280-119170302 GGCTGGCCTGGTTGTTTTGGGGG + Intergenic
938273224 2:129993437-129993459 GGATGGCCTTGTTGTCGTGCGGG - Intergenic
948870915 2:240797613-240797635 GGCCGACCCCGATGCTGTGCAGG + Intronic
1170177550 20:13489204-13489226 GGGTGGCCTCGTTCTTGTGGAGG - Intronic
1173175831 20:40764013-40764035 GGCTGGGCTCGAGGTTGTGCTGG + Intergenic
1179792753 21:43764879-43764901 GGCCGGCCTCGTGGAGGTGACGG - Intergenic
1184261341 22:43318642-43318664 GGCAGGCGTCTTAGTTGTGCTGG - Intronic
1184653758 22:45931103-45931125 TGCCGGCCTCATTGTTATGCAGG + Exonic
1184908386 22:47508540-47508562 GGGCGGCCTCTTTGTGTTGCTGG - Intergenic
952301368 3:32106881-32106903 GGGCGACCTCGTTGCTGGGCTGG + Intronic
954392159 3:50273528-50273550 GGCCGCCCACGTCGTTCTGCCGG - Exonic
955058158 3:55474342-55474364 GGCCGGCCTCGTTGTTGTGCAGG + Exonic
955155844 3:56415835-56415857 GGCTGTCCTATTTGTTGTGCTGG - Intronic
955791058 3:62589302-62589324 GGCCTGCCTGGCTCTTGTGCTGG - Intronic
968066621 3:195762667-195762689 GGCCGGGTGCGTTGTGGTGCAGG - Intronic
968066637 3:195762733-195762755 GGCCGGGTGCGTTGTGGTGCAGG - Intronic
968743188 4:2341498-2341520 GGCCGGCCAGGTTGTCGTGCCGG + Exonic
982292478 4:153792687-153792709 GGGCGTCCTCGTTGTGGGGCCGG - Intergenic
985378884 4:189371584-189371606 GGTCTGTCTCGTTGATGTGCAGG + Intergenic
985569896 5:639199-639221 GGAATGCCTCGTTGCTGTGCAGG - Exonic
988866305 5:35338886-35338908 GGCTGGCCTCGTGGTGGTGAGGG - Intergenic
1002212364 5:177606607-177606629 GACCGCCCTAGCTGTTGTGCTGG - Intronic
1023890619 7:44389378-44389400 GGCCGGCCTCCTTATTTTGATGG - Intronic
1024920699 7:54550907-54550929 GGACGGCCGCGGGGTTGTGCAGG - Intronic
1033810081 7:145002009-145002031 GGGCAGCCTCCTTGATGTGCTGG + Intergenic
1035262314 7:157669838-157669860 GCCCGGCCTCGAGGTTGTGTGGG - Intronic
1035402645 7:158577317-158577339 GGCAGCCCTCAGTGTTGTGCAGG - Intronic
1049796681 8:144500274-144500296 GGGCGGCCTCGATGCTGTCCTGG - Exonic
1061855848 9:133441597-133441619 GGCTGGCCTCTTTCTTGGGCTGG + Intronic
1201958410 Y:19651027-19651049 GGGCTGCCTCGTTGTTGTTGGGG - Intergenic