ID: 955058535

View in Genome Browser
Species Human (GRCh38)
Location 3:55476645-55476667
Sequence TTTGTATTCTGCGGCATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955058535_955058540 4 Left 955058535 3:55476645-55476667 CCTTTTATGCCGCAGAATACAAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 955058540 3:55476672-55476694 GGAGATCCCTCTAAGCTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 50
955058535_955058543 14 Left 955058535 3:55476645-55476667 CCTTTTATGCCGCAGAATACAAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 955058543 3:55476682-55476704 CTAAGCTAATTGGTCACTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 93
955058535_955058544 15 Left 955058535 3:55476645-55476667 CCTTTTATGCCGCAGAATACAAA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 955058544 3:55476683-55476705 TAAGCTAATTGGTCACTGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955058535 Original CRISPR TTTGTATTCTGCGGCATAAA AGG (reversed) Intronic
901915701 1:12497977-12497999 CTAGCATTCTGCGGCAAAAATGG - Intronic
903089179 1:20894522-20894544 TTTGCAGCCTCCGGCATAAATGG - Intronic
904215972 1:28919623-28919645 TTTGTATTCTTTGGTAGAAACGG + Intronic
911979430 1:104548135-104548157 TTTATATTCTGTGGTATAAATGG - Intergenic
912319264 1:108694974-108694996 TTTATATTCTGGGGAATAATTGG + Intronic
913298004 1:117340532-117340554 ATTATTTTCTGAGGCATAAATGG - Intergenic
913406627 1:118501095-118501117 TATTTATTGTGAGGCATAAAAGG - Intergenic
916044235 1:160986982-160987004 TTTGGATCCTGCGGGAGAAAAGG + Intergenic
916625262 1:166548953-166548975 TTTGTATTCTGTGGGATCAGTGG + Intergenic
918440092 1:184558262-184558284 TTTATATTCTGTGACATACATGG - Intronic
919198735 1:194323458-194323480 TTTGTTTTCTGCGGTTCAAAAGG - Intergenic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
922331879 1:224584467-224584489 ATTGTCTACTCCGGCATAAAGGG - Intronic
923285007 1:232485830-232485852 TTAGTATTCTTCGGTATTAACGG - Intronic
923632714 1:235663946-235663968 ATTGTATTCTGAAGCATAAGAGG + Intronic
1064223673 10:13463122-13463144 TTTGCAATCTCCAGCATAAATGG - Intronic
1065399628 10:25283409-25283431 TTTGCAATCTTCAGCATAAATGG - Intronic
1066566334 10:36725481-36725503 TTTGTATTATGAGACAAAAATGG - Intergenic
1067688512 10:48483354-48483376 TTTGCAACCTCCGGCATAAATGG + Intronic
1068523152 10:58099745-58099767 TTTGTATCCTGTGCCATATATGG - Intergenic
1068899976 10:62257101-62257123 TTGGTGTTCTGCGGGATATAAGG + Intronic
1069085857 10:64138819-64138841 TCTATATTCTGCGTCAGAAAAGG - Intergenic
1069336091 10:67352511-67352533 TTTTTATTCTTTTGCATAAAGGG - Intronic
1072793557 10:98336931-98336953 TTTGTAATCTCCTTCATAAAAGG - Intergenic
1073505825 10:103988523-103988545 TTTGCAACCTCCGGCATAAATGG + Intronic
1082092344 11:48100221-48100243 CTTGGATTCTGCTGCATGAAAGG - Intronic
1083047391 11:59749140-59749162 TTTCTTTGCTGCTGCATAAAGGG - Intronic
1090539317 11:127683089-127683111 GTTGTGTTCTGCAGGATAAATGG - Intergenic
1090718548 11:129452173-129452195 TTTGTGACCTTCGGCATAAATGG + Exonic
1093316068 12:17651662-17651684 TTAGTATTTGGCAGCATAAAGGG - Intergenic
1094771927 12:33672446-33672468 TTTGTATTCTTCGGTAGAGATGG + Intergenic
1100227147 12:92570368-92570390 TTTGTTCTCTGCTGCACAAAAGG - Intergenic
1102850831 12:116243275-116243297 TTTGCATCCTCCTGCATAAATGG - Intronic
1106891638 13:34252489-34252511 TTTCTATTCTTTGGCATAACAGG + Intergenic
1106976874 13:35229033-35229055 TTTGTTTTCTGTGGCAAAATAGG + Intronic
1107688486 13:42928106-42928128 TTTATATCCTGCGGCATGAGTGG - Intronic
1108648320 13:52451594-52451616 TTTGTATTTTGCTTTATAAATGG + Intergenic
1111913337 13:94335928-94335950 TTGGTCATCTGCAGCATAAAGGG + Intronic
1112431292 13:99352667-99352689 CGTGTATTCTGCGGAATAGACGG - Intronic
1112575350 13:100630637-100630659 TTTGTATTCTGAGGACTACAAGG - Intronic
1112811855 13:103227309-103227331 TTTGTAGTCTGAGGAAGAAAGGG + Intergenic
1117166700 14:53041716-53041738 TTTTGAATCTGAGGCATAAACGG + Intronic
1117841915 14:59869813-59869835 TTTGTTTTCTGCGGGAGAAAAGG + Intronic
1117882540 14:60326454-60326476 TTTGTATTCTTCTGAATGAAAGG + Intergenic
1120629250 14:86869336-86869358 TGTGTATTCTGCTGTATCAATGG - Intergenic
1120980758 14:90287078-90287100 TTTGCATTCTGCTGATTAAAGGG - Intronic
1128571548 15:68737218-68737240 TTTGTATTCTTCTGCAGAGATGG - Intergenic
1131630407 15:94170347-94170369 TTTGTATCCTGCGACATTACTGG - Intergenic
1134802400 16:17097397-17097419 ATTGTATTTTGAGGAATAAAGGG + Intergenic
1135113217 16:19706839-19706861 TTTGTAATCTCCAGCATAAATGG + Exonic
1139775669 16:69315684-69315706 TTTCTATTCTGCTGCCTCAAGGG - Intronic
1140192724 16:72831950-72831972 TTTGCAATCTCCAGCATAAATGG + Intronic
1148916817 17:50988244-50988266 TTTGCAACCTCCGGCATAAATGG - Intronic
1149538877 17:57453763-57453785 TTTGCAACCTCCGGCATAAATGG + Intronic
1149987813 17:61361123-61361145 TTTATTTTCTGTGTCATAAATGG + Intronic
1150179952 17:63108039-63108061 TTTGTAGCCTCTGGCATAAATGG - Intronic
1150749665 17:67848720-67848742 TTTGTATTCTGTAACACAAAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153547510 18:6223784-6223806 TTTCTATTCTCCGGCTGAAATGG + Intronic
1153621742 18:6985636-6985658 TTTTTATCCTGCAGCAGAAACGG + Exonic
1156228674 18:35133175-35133197 CTAGTATTTTGAGGCATAAATGG - Intronic
1160151820 18:76401189-76401211 TTTGCAACCTCCGGCATAAATGG + Intronic
1164342475 19:24420280-24420302 TTTGTAGCCTACGGCAGAAAAGG + Intergenic
926108080 2:10164958-10164980 TTTGAATTCTGCCGCACAGAGGG + Intronic
929344302 2:40862336-40862358 TTTGCAACCTCCGGCATAAATGG - Intergenic
930525766 2:52527434-52527456 TTTGTTTTCTGCTGCCCAAAAGG - Intergenic
931303138 2:61000853-61000875 TTTGCAATCTCCAGCATAAATGG + Intronic
931980692 2:67691052-67691074 TTTGGATTCTGCATCATTAAAGG + Intergenic
932637423 2:73403875-73403897 TTTGTATCCTGCGGCTTTACTGG + Intronic
935760611 2:106317194-106317216 TTTGTGATCTGCAGCATGAATGG - Intergenic
936007534 2:108904602-108904624 GTAGTAGTCTGTGGCATAAATGG - Intronic
940979036 2:159980663-159980685 TTTGTACTCTGCCTCATAGAAGG - Intronic
941774815 2:169381608-169381630 TTTGTAGTTTCCAGCATAAAAGG - Intergenic
941813408 2:169776731-169776753 TGTGTATTCTGGGACATACAAGG + Intronic
942477217 2:176340067-176340089 TTTGTATACTGAGGTACAAATGG - Intergenic
942609113 2:177723867-177723889 TTTGTATTCTGTAAAATAAAAGG - Intronic
943948243 2:194094750-194094772 TTTGTATTCTACGTTATACATGG + Intergenic
947023675 2:225712407-225712429 TTTGTATTCTTCTGGAGAAAAGG + Intergenic
947346558 2:229197072-229197094 TATGTTATCTGGGGCATAAAAGG - Intronic
947380603 2:229541577-229541599 ATTGTATCCTCCAGCATAAATGG + Intronic
1173028448 20:39331885-39331907 TCTTCATTCTGCAGCATAAATGG - Intergenic
1173170582 20:40720400-40720422 TTGTTTTTCTGCTGCATAAAGGG + Intergenic
1174684196 20:52437915-52437937 TTTGCAACCTCCGGCATAAATGG - Intergenic
1176192532 20:63818999-63819021 TTTGTATTCTGTAGTAGAAACGG - Intronic
1176319019 21:5289248-5289270 TTTGTGGTCTGTGGCAGAAAAGG - Intergenic
1176320519 21:5315793-5315815 TTTGCAGTCTGTGGCAGAAAAGG - Intergenic
1176477905 21:7245813-7245835 TTTGCAGTCTGTGGCAGAAAAGG - Intergenic
1182393417 22:30018402-30018424 TTTGTCTTCTGAGGCTTAAAAGG + Intronic
1182583711 22:31330736-31330758 TTTGTAACCTCCAGCATAAATGG + Intronic
1182969767 22:34562815-34562837 ATTATAACCTGCGGCATAAATGG + Intergenic
1184146872 22:42616939-42616961 TGTGAATTCTGCAGCGTAAAGGG + Intergenic
951311203 3:21128199-21128221 TTTGTATTCTGTGGGATCCATGG - Intergenic
953148336 3:40300473-40300495 TTAGTATTCTGCTGAATACATGG - Intergenic
953542463 3:43834223-43834245 TTTGCATTGGGAGGCATAAATGG + Intergenic
953595287 3:44306763-44306785 TTTGCAATCTCTGGCATAAATGG - Intronic
954643395 3:52115720-52115742 TTTGTTTTCTGCTTCATAGATGG - Intronic
955058535 3:55476645-55476667 TTTGTATTCTGCGGCATAAAAGG - Intronic
956308671 3:67854716-67854738 TTTGTCTTCTGCTGCCTACAGGG - Intergenic
956574803 3:70740415-70740437 TTTGTATGTTGTGGCATTAATGG - Intergenic
957594477 3:82244584-82244606 GTTGTATTCTGAGGTATTAAAGG - Intergenic
958524734 3:95241191-95241213 TTTGTATTCTCTTGCTTAAAGGG + Intergenic
963584728 3:147171739-147171761 TTTTTATACTTCTGCATAAAGGG - Intergenic
964090097 3:152865621-152865643 TTTTTATTCTGTTACATAAAAGG + Intergenic
966087637 3:176088777-176088799 TTTTTATTCTTCATCATAAAGGG + Intergenic
967419826 3:189260667-189260689 TTTGCATTCTGCAACATAGAAGG + Intronic
967582369 3:191174249-191174271 TTTGTATTTTCTGGCAGAAAGGG - Intergenic
967867837 3:194204557-194204579 CTTTTATTTTGCGCCATAAAGGG - Intergenic
970061782 4:12041852-12041874 ATTGCATTCTCAGGCATAAATGG - Intergenic
970950242 4:21747188-21747210 TTTTATTTCTGGGGCATAAATGG - Intronic
971111203 4:23588026-23588048 TTTATTGTCTGTGGCATAAATGG + Intergenic
973837068 4:54820186-54820208 CTTGTATTATGCAGCATAATTGG - Intergenic
974328973 4:60451684-60451706 TTTGTACTCTGAGCAATAAATGG + Intergenic
976076167 4:81301340-81301362 TTTGTATTCTTTTCCATAAATGG - Intergenic
976805466 4:89041402-89041424 TTTGCAACCTTCGGCATAAATGG - Intronic
977542780 4:98338354-98338376 TTTGTTTTCTGTTGCATAAAAGG + Intronic
978590975 4:110324639-110324661 TTTGTATTCTGTGGGATCAGTGG + Intergenic
981874760 4:149528911-149528933 TTTTTATTCTGCTGCACTAAAGG + Intergenic
984139288 4:175982910-175982932 TTTGTATTTTTCTGCATAAACGG + Intronic
987575971 5:19729184-19729206 TTTATATTCTGTTCCATAAATGG + Intronic
989832073 5:45932381-45932403 TTTGTATTCTGTGGGATCAGTGG - Intergenic
989914638 5:49708205-49708227 TTTGTAGCCTACGGCAGAAAAGG + Intergenic
993017480 5:82551600-82551622 TCTGTATTCTGCAGCACAGATGG - Intergenic
994406976 5:99357500-99357522 TTTCTAATCTGTGACATAAAAGG - Intergenic
994792909 5:104254344-104254366 TTTGTATTCTGCAGCTTTATTGG + Intergenic
994905041 5:105830006-105830028 TTTGTATTCTGTGGGTTAACTGG + Intergenic
995792460 5:115905127-115905149 TTTGCAACCTCCGGCATAAATGG + Intronic
997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG + Intronic
1001374097 5:171238273-171238295 TTTGCAACCTTCGGCATAAATGG + Intronic
1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG + Intergenic
1003523540 6:6879563-6879585 TTTGTGTTCTGGGACATTAATGG + Intergenic
1004056352 6:12142707-12142729 TTTGTATTCTGTGGGATCAGTGG - Intronic
1004256619 6:14070392-14070414 TTTGTAGTCAGCGGGATACAAGG + Intergenic
1008198506 6:48556243-48556265 TTTGTATTTTGCTGCATTTATGG + Intergenic
1008222355 6:48871036-48871058 TTTATATTCTTCTGGATAAATGG + Intergenic
1008301048 6:49839966-49839988 TTTGTATTGTGCTACATACATGG + Intronic
1010172289 6:72987799-72987821 CTTGTAATCTCCAGCATAAATGG - Intronic
1013671729 6:112410772-112410794 TTGGTATTCTTCTGCATAGATGG - Intergenic
1014487859 6:122022624-122022646 TTTGTATTGTGTGCCAGAAAAGG - Intergenic
1017541005 6:155403230-155403252 TTTGTTTTCTGCTGTGTAAAAGG - Intronic
1022403763 7:30066811-30066833 TTTCTATTCTGTGCCAGAAAAGG - Intronic
1024092806 7:45960561-45960583 TTTGTATTTTGTAGCAGAAACGG + Intergenic
1024664598 7:51533632-51533654 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1030025519 7:105320721-105320743 TTTGCAACCTTCGGCATAAATGG - Intronic
1030768644 7:113443859-113443881 TTTATATTCTGAGGCATACAAGG - Intergenic
1031644656 7:124209476-124209498 TTTGTATTCTTTAGCATACAAGG + Intergenic
1034504927 7:151480983-151481005 TTTGCAACCTCCGGCATAAATGG - Intronic
1036615372 8:10383468-10383490 TTTGGTTCCTGCGGCTTAAAAGG + Intronic
1037049977 8:14360805-14360827 GTTGTACTCTGCGGCATTTATGG - Intronic
1038301926 8:26359285-26359307 TTTGAATTCTGGAGCAGAAAAGG + Intronic
1039694629 8:39897442-39897464 TTTGTATTCTTAGTAATAAAGGG - Intergenic
1042168711 8:65972000-65972022 CTTGTCTTCTGCTCCATAAATGG - Intergenic
1043338935 8:79213571-79213593 GTTGTCTTCTGCGGCACACATGG + Intergenic
1043430126 8:80186394-80186416 TTTGTATTATGCTGTCTAAAAGG + Intronic
1044351368 8:91170295-91170317 TGTGTTTTTTGCTGCATAAATGG + Intronic
1045851184 8:106699745-106699767 TGTGCATTCTGCTGCACAAAAGG + Intronic
1046726052 8:117675094-117675116 TTTGCATTCTGAGTCATAGAAGG - Intergenic
1047575692 8:126152105-126152127 ACTATATTCTGAGGCATAAATGG + Intergenic
1048670228 8:136710813-136710835 TTTGGTTACTGCAGCATAAATGG + Intergenic
1054951850 9:70860904-70860926 ATTGTATTCTGTTGTATAAATGG - Intronic
1058998363 9:110322155-110322177 TTTGTATAATGTGACATAAATGG + Intronic
1060374518 9:123106497-123106519 TTTGTAACCTCTGGCATAAATGG - Intergenic
1186827552 X:13356125-13356147 TTTGTATTTTTCTCCATAAAAGG + Intergenic
1188338267 X:28966227-28966249 TTTGTTTTCTGAAGCATAAATGG + Intronic
1190594410 X:52038436-52038458 TTTGCTTTCTGCTGTATAAAGGG - Intergenic
1194357168 X:92899978-92900000 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1197640794 X:128966177-128966199 TATGTATTATGGGGCATCAAAGG - Intergenic
1199726831 X:150591715-150591737 TTTGCAACCTCCGGCATAAATGG + Intronic
1200274419 X:154718247-154718269 TTTTTATTCTAAGGCATAATTGG - Intronic
1200665501 Y:6016973-6016995 TTTGTATTCTGTGGGATCAGTGG + Intergenic
1202071587 Y:20997218-20997240 TGTGTATTTTGCTACATAAAAGG - Intergenic