ID: 955059592

View in Genome Browser
Species Human (GRCh38)
Location 3:55483944-55483966
Sequence TAAGGGACTGCCTGCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955059592_955059602 28 Left 955059592 3:55483944-55483966 CCTCCTCCGCAGGCAGTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 955059602 3:55483995-55484017 ATCCTCTCCCCTCGGCCCCGGGG 0: 1
1: 0
2: 0
3: 28
4: 348
955059592_955059600 26 Left 955059592 3:55483944-55483966 CCTCCTCCGCAGGCAGTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 955059600 3:55483993-55484015 AGATCCTCTCCCCTCGGCCCCGG 0: 1
1: 0
2: 4
3: 22
4: 187
955059592_955059597 -5 Left 955059592 3:55483944-55483966 CCTCCTCCGCAGGCAGTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 955059597 3:55483962-55483984 CCTTAAGAGAATAGATAAAAAGG 0: 1
1: 0
2: 1
3: 29
4: 427
955059592_955059599 20 Left 955059592 3:55483944-55483966 CCTCCTCCGCAGGCAGTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 955059599 3:55483987-55484009 AAGCAAAGATCCTCTCCCCTCGG 0: 1
1: 0
2: 2
3: 17
4: 212
955059592_955059601 27 Left 955059592 3:55483944-55483966 CCTCCTCCGCAGGCAGTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 955059601 3:55483994-55484016 GATCCTCTCCCCTCGGCCCCGGG 0: 1
1: 3
2: 11
3: 148
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955059592 Original CRISPR TAAGGGACTGCCTGCGGAGG AGG (reversed) Intronic
902007118 1:13241155-13241177 TAAGGGACTGACTGATAAGGTGG - Intergenic
902026170 1:13385459-13385481 TAAGGGACTGACTGATAAGGTGG - Intergenic
904624242 1:31793245-31793267 TAAGGGAATCCCTGGCGAGGAGG + Intronic
906275611 1:44513060-44513082 TAAGGGATTGGCTGCAGTGGGGG - Intronic
906579507 1:46924916-46924938 TAAGGGACTGCCTCCTCAAGTGG - Intergenic
906604211 1:47153970-47153992 TAAGGGACTGCCTCCTCAAGTGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
920415499 1:205796761-205796783 GAAGGGACTGCTTACAGAGGTGG - Intronic
922802183 1:228369496-228369518 TAAGGATCAGCCTGCTGAGGAGG - Intronic
923606552 1:235448570-235448592 TAAGCTACTGCCTGGGGACGGGG + Intronic
1063464392 10:6233484-6233506 TCAGGGACTTCCTGCAGAAGAGG - Exonic
1063567091 10:7180496-7180518 CCAGGGACTGACTGTGGAGGAGG + Intronic
1067217167 10:44312769-44312791 TCAGGCACAGCCTGAGGAGGTGG - Intergenic
1069994405 10:72333687-72333709 GAAGGGAAGGCCTGCAGAGGGGG - Exonic
1072228109 10:93388509-93388531 TAAAAGACTGGCTGTGGAGGTGG - Intronic
1076924526 10:133475744-133475766 TGAGGGACTGCCTGGGCTGGGGG + Intergenic
1076924573 10:133475879-133475901 TGAGGGACTGCCTGGGCTGGGGG + Intergenic
1077410726 11:2402786-2402808 GATGGGGCTGCCTGGGGAGGAGG + Exonic
1078141912 11:8699212-8699234 GAAGGAGCTGCCTGTGGAGGAGG - Exonic
1079121439 11:17688107-17688129 TAATTTACTGCCTGAGGAGGGGG - Intergenic
1083609867 11:63999618-63999640 TGAGGGACGGCCCGCGGGGGAGG - Intronic
1084266940 11:68010031-68010053 TGAGGGCCAGCCTGAGGAGGAGG - Intronic
1084266950 11:68010088-68010110 TGAGGGGCAGCCTGAGGAGGAGG - Intronic
1084677396 11:70643900-70643922 TAAGGGACTGCAGGTGGAGGGGG + Intronic
1085259226 11:75194672-75194694 CCAGGGACTTCCTGAGGAGGTGG - Intronic
1085395592 11:76205666-76205688 GAAGGGAGTGCCTGCTCAGGGGG - Intronic
1086167917 11:83801147-83801169 TAAGGGATTGCATGGGGAGGTGG - Intronic
1091777300 12:3192782-3192804 TGAGGGCCTCCCTGAGGAGGAGG + Intronic
1091807334 12:3365939-3365961 TCAGGGACTGCGGGCGGCGGAGG + Intergenic
1093533330 12:20193564-20193586 TAAGTGGTTGCCTGGGGAGGGGG - Intergenic
1101807363 12:108076110-108076132 TAAGGAGCTGCCTGAGGAGAGGG - Intergenic
1102570755 12:113825629-113825651 TAAGGGATGGCCAGCGGTGGCGG + Intronic
1103537303 12:121641715-121641737 TCACGGACAGCCTGCGCAGGGGG + Exonic
1105472443 13:20705020-20705042 AAAGGGACAGCCTGCAGAAGGGG + Intronic
1105596311 13:21842655-21842677 CAAGTGACTGCCTGGGGTGGGGG + Intergenic
1110978391 13:81867804-81867826 TGAGGGGCAGCCTGGGGAGGAGG - Intergenic
1122639613 14:103150873-103150895 AAAGGGGCTGCCTGGGGTGGTGG - Intergenic
1124811533 15:32944095-32944117 GAAGGGAGTGCCTGGGGAAGGGG + Intronic
1124962610 15:34409908-34409930 TGAGGGCCTCCCTGAGGAGGAGG + Intronic
1124979235 15:34556130-34556152 TGAGGGCCTCCCTGAGGAGGAGG + Intronic
1128136364 15:65266531-65266553 TAAGGGACACCCTGCTGATGTGG - Intronic
1128339483 15:66810516-66810538 TAAGGGAAAGGCTGAGGAGGAGG + Intergenic
1129025709 15:72571822-72571844 AAATGGACTGCCTCAGGAGGTGG + Intronic
1129709419 15:77812940-77812962 TAAGGGACTACCCAAGGAGGAGG + Intronic
1129782181 15:78279860-78279882 TCAGGTACTGCCTGGGGAAGGGG - Intronic
1133889860 16:9868692-9868714 GAAGGGAAGGCCTGGGGAGGAGG - Intronic
1133933973 16:10254139-10254161 TAAGGGAAGGCCTGAGGAGGTGG - Intergenic
1133939623 16:10297471-10297493 AAAGGGACTGCATGAAGAGGGGG + Intergenic
1138225684 16:55292404-55292426 TAAGGGAGTAGCTGGGGAGGGGG + Intergenic
1138333742 16:56235569-56235591 TAGGGGAATGCCTGCTGAGAGGG + Intronic
1139354821 16:66361220-66361242 AGAGGGACTGGCTGGGGAGGAGG - Intergenic
1139482094 16:67236387-67236409 TAAGTGACTGCCAGCGGGTGGGG - Intronic
1141648348 16:85379204-85379226 GATGGCACTGCATGCGGAGGAGG - Intergenic
1142290668 16:89192490-89192512 CAGGGGACGGCCTGGGGAGGAGG - Intronic
1143172922 17:4940433-4940455 GGAGGGACTGCCTGTGGAGATGG - Intronic
1144923684 17:18784953-18784975 TGATGGACTGACTGGGGAGGTGG - Intronic
1145209685 17:21003981-21004003 TAAGGGAATGCCTCCAGAGAGGG + Intronic
1145880485 17:28349277-28349299 TATGGGAGTGCCTGCTGTGGTGG - Intronic
1146429132 17:32773997-32774019 CAAGGCACAGCCTGGGGAGGAGG - Intronic
1147149890 17:38508653-38508675 TGAGGGCCTGCCGGAGGAGGAGG + Intronic
1148478665 17:47945881-47945903 GAAGAAACTGCCTGAGGAGGAGG + Exonic
1149309664 17:55381862-55381884 TAAGGCAGTGCCTGTGGAGAAGG + Intergenic
1150336424 17:64333855-64333877 GAGGGGCCTGCCTGGGGAGGTGG + Intronic
1151649402 17:75456876-75456898 TAAGGGGATGCCTCCTGAGGGGG + Intronic
1151824763 17:76518079-76518101 AAAGGGCCTGCCTGGGAAGGGGG - Intergenic
1152005295 17:77676610-77676632 GGAGGGAGTGCCTGCCGAGGAGG + Intergenic
1152397087 17:80040078-80040100 TCAGGAACTGCCTGGAGAGGAGG + Exonic
1152643042 17:81457122-81457144 GAAGGGACTTTCTGGGGAGGGGG + Intronic
1152896768 17:82915867-82915889 TAATGGACTTCCTGCTGTGGGGG + Intronic
1153531567 18:6051720-6051742 TGTGGGACTGTCTGAGGAGGTGG + Intronic
1153984931 18:10343473-10343495 TAAGGTGCTGCCTGGGGAGGCGG + Intergenic
1157193551 18:45601069-45601091 TAAGGGACAGCCTAGGGAAGTGG - Intronic
1157722743 18:49937849-49937871 AAAGGGAGTGCCTGCTAAGGGGG + Intronic
1157906491 18:51574116-51574138 TGAGGGGCAGCCTGGGGAGGAGG + Intergenic
1160621740 18:80175982-80176004 TGAGGGGCTTCCTGAGGAGGTGG + Intronic
1161012774 19:1968308-1968330 TCAGGGGCAGCCTGGGGAGGAGG - Intronic
1161390439 19:4017612-4017634 GAGGGGACAGCCTGGGGAGGGGG + Intronic
1161723273 19:5915167-5915189 CGAGGAACTGCCTGGGGAGGGGG - Intronic
1162805376 19:13135597-13135619 CCAGGGCCTGCATGCGGAGGAGG + Exonic
1164243394 19:23409725-23409747 TTAGAGGCTGGCTGCGGAGGTGG - Intergenic
928366530 2:30707144-30707166 GAAGTGACAGCCTGAGGAGGAGG + Intergenic
929311246 2:40428527-40428549 GAAGGGACTGCCAGAGGTGGAGG - Exonic
931591463 2:63888134-63888156 ATAGGGAATGCCTGGGGAGGTGG + Intronic
933457983 2:82541298-82541320 TGAGGGACTGCTGGTGGAGGAGG - Intergenic
937988072 2:127647569-127647591 TGAGGGACAGCCTGGGGTGGAGG + Intronic
943149782 2:184097697-184097719 TAAGGGCCTGCCTGGGCATGGGG + Intergenic
944199114 2:197086540-197086562 GAAGGGACTTCCTTCCGAGGAGG + Intronic
944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG + Intergenic
946855429 2:223945307-223945329 TGATGGGCTGCCTGCCGAGGAGG - Exonic
949042242 2:241854719-241854741 CGAGGGGCTGCCTGCGGTGGTGG - Intronic
1170349664 20:15424953-15424975 TTAGGGGCCGCCTGAGGAGGAGG + Intronic
1172221280 20:33276725-33276747 GCAGGGACAGCCTGAGGAGGAGG + Intronic
1172885829 20:38230137-38230159 TAATGGACTGGCTGGGGAAGAGG - Intronic
1175321564 20:58091962-58091984 TAGGGGACTCCCTGCCGATGGGG + Intergenic
1180846557 22:18986021-18986043 TAAGGCACTGGCTGCGTTGGGGG + Intergenic
1182358651 22:29734220-29734242 TCAGGGTCAGTCTGCGGAGGGGG + Intronic
1183562142 22:38583592-38583614 AAAGGGAATGCCTGCCTAGGAGG - Intronic
949836296 3:8274114-8274136 TCAGGGATTTCCTGCTGAGGAGG + Intergenic
949888174 3:8712793-8712815 CCAGGGGCTGCCTGGGGAGGTGG - Intronic
950677683 3:14564454-14564476 GAGGGGACGGCCTGCCGAGGGGG + Intergenic
951762892 3:26164439-26164461 TGAGGGGCAGCCTGGGGAGGAGG + Intergenic
953344119 3:42160668-42160690 CAAGGGACTTCCTGAGGAGCTGG - Intronic
954197371 3:49004736-49004758 TAAGGGACTTCCAGGGGAGGTGG + Intronic
955059592 3:55483944-55483966 TAAGGGACTGCCTGCGGAGGAGG - Intronic
956892752 3:73628260-73628282 TAAGGGAGTGCCTCCTGAGCTGG - Intergenic
958261206 3:91383240-91383262 TAAGGGACTGCCTCCTCAAGTGG - Intergenic
962826431 3:139104138-139104160 TAAGGGACTGCATGGGTGGGTGG + Intronic
962878870 3:139557359-139557381 GAAGGGTCTGCCTGTGGAGCTGG - Intergenic
963468525 3:145712031-145712053 TAAGGAGCAGCCTGGGGAGGAGG - Intergenic
968635413 4:1675909-1675931 TGAGGCACTGCCTGTGGTGGGGG - Intronic
968671260 4:1853009-1853031 GAAGAGATTGCCTGGGGAGGAGG - Intronic
968766355 4:2472580-2472602 TAAGAGACTGGCAGTGGAGGGGG - Intronic
968922761 4:3531141-3531163 TAATGTTCAGCCTGCGGAGGTGG - Intronic
969399974 4:6948043-6948065 GGAGGGACTGCGTGGGGAGGGGG + Intronic
972395758 4:38658398-38658420 CCAGGGAGTGCCTGCGGAAGTGG - Intergenic
985113935 4:186572895-186572917 CAAGGGACTGTCCGGGGAGGAGG + Intergenic
990565705 5:57026420-57026442 TCAGTGACTGCCTGCGTATGGGG + Intergenic
990793773 5:59516276-59516298 AAAGTGACTGCCTGGGGAGGAGG - Intronic
991660443 5:68945562-68945584 TAAGGGAAGGCCTCTGGAGGAGG + Intergenic
992460465 5:76954716-76954738 TAGGGGACTGGCTGCCGAGGGGG + Intronic
992649293 5:78842001-78842023 TTAGGGACTTCCTGAGGGGGAGG + Intronic
995824153 5:116274763-116274785 TAAGAGACTGCCTTGAGAGGTGG - Intronic
997716594 5:136047422-136047444 TAAGGGACTGCCCTGGGTGGAGG + Intronic
999232163 5:150068109-150068131 TGATGGACTGACTGAGGAGGAGG + Intronic
1002521335 5:179794618-179794640 TAAGGCACAGCCTGGGGAGGGGG + Intronic
1006180479 6:32150810-32150832 GAAGGGGCTGCCTGTGGCGGTGG + Exonic
1006340961 6:33446788-33446810 TGAGGGGCGGCCTGGGGAGGGGG + Intronic
1007763311 6:44146929-44146951 TAAGGGACTGGGGGCAGAGGAGG + Intronic
1008993957 6:57636910-57636932 TAAGGGACTGCCTCCTCAAGTGG + Intronic
1009182560 6:60536000-60536022 TAAGGGACTGCCTCCTCAAGTGG + Intergenic
1010120521 6:72370465-72370487 TAAAGAACTTCCTGCTGAGGAGG - Intronic
1011462575 6:87620172-87620194 TAAGGGGCTTGCTGCGGAAGAGG - Intronic
1014266552 6:119284347-119284369 GAAGGGTCTTCCTGCTGAGGGGG + Intronic
1018384767 6:163292151-163292173 TAAGGGACAACGTGCGGTGGTGG + Intronic
1021508426 7:21410075-21410097 GTAGGGACTACCTGTGGAGGTGG - Intergenic
1023610660 7:41967311-41967333 TAAGGGAATGCCAGCAGTGGAGG - Intronic
1026901572 7:74040275-74040297 GAAGCGACTGCCAGCGCAGGTGG + Intronic
1028193363 7:87876789-87876811 AAAGGGACTGCAGGCGGAGGAGG - Intronic
1034265211 7:149777419-149777441 CATGGGAGTGCCTGGGGAGGCGG - Intergenic
1037313081 8:17576829-17576851 TCAGGTTCTGCCTGAGGAGGTGG + Intronic
1039890168 8:41680609-41680631 GTAGGGACTTCCTGCAGAGGTGG - Intronic
1043359294 8:79452068-79452090 TCAGGGACTACCTGGGGAGCAGG + Intergenic
1043523706 8:81073815-81073837 GTAGGGACTGCCTGGGGAGTGGG + Intronic
1046552083 8:115730608-115730630 GAAGGGGCTGCCTGCTGAGATGG - Intronic
1049566805 8:143344534-143344556 TAAGGGAGTGGCTGGGGAGTGGG - Intronic
1049722457 8:144125659-144125681 TACCGGACAGCCCGCGGAGGAGG + Intergenic
1049722517 8:144125897-144125919 TACCGGACAGCCCGCGGAGGGGG + Intergenic
1053073391 9:35114383-35114405 TGAGAGACTGGCTGGGGAGGGGG - Intronic
1055406072 9:75974690-75974712 TAAGGGACTGCCTTGGGGGAAGG - Intronic
1056040171 9:82657576-82657598 TAAGGGACACCATGCGGAGGAGG + Intergenic
1057314674 9:93960679-93960701 CAAGGGAGGGCCTGCGGAGTCGG - Intergenic
1058689505 9:107507482-107507504 ACAGGGCCTGGCTGCGGAGGTGG + Intergenic
1059356014 9:113700059-113700081 AAAGGGACTGCCCACGGTGGGGG - Intergenic
1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG + Intergenic
1061091776 9:128430626-128430648 TAGGGGGCTGCCTGAGGGGGAGG - Intronic
1061858707 9:133456965-133456987 TGAGGGACTGACTGAGGATGTGG - Intronic
1062305416 9:135903894-135903916 TAAGAGACTGAGTGGGGAGGGGG - Intronic
1062595481 9:137297157-137297179 AAGGGGCCTGCCTGGGGAGGGGG + Intergenic
1186291688 X:8107379-8107401 TGTGTGACTGCCTGAGGAGGTGG + Intergenic
1186744784 X:12556409-12556431 TTATGCACTGCCTACGGAGGGGG + Intronic
1189933141 X:46036186-46036208 TTCTGGGCTGCCTGCGGAGGAGG + Intergenic
1193885845 X:86983469-86983491 TAAGGAGCAGCCTGGGGAGGAGG - Intergenic