ID: 955060632

View in Genome Browser
Species Human (GRCh38)
Location 3:55489027-55489049
Sequence CCTGCCACGGAGATCTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955060626_955060632 3 Left 955060626 3:55489001-55489023 CCAGAGCATGAGGCGCGATGCGT 0: 1
1: 0
2: 0
3: 0
4: 24
Right 955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 112
955060625_955060632 4 Left 955060625 3:55489000-55489022 CCCAGAGCATGAGGCGCGATGCG 0: 1
1: 0
2: 0
3: 2
4: 24
Right 955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 112
955060624_955060632 8 Left 955060624 3:55488996-55489018 CCGGCCCAGAGCATGAGGCGCGA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955060632 Original CRISPR CCTGCCACGGAGATCTTGGC GGG Intronic
901459088 1:9380967-9380989 CCTGCCACGGAGAGCTGGTAGGG - Intergenic
901510548 1:9716238-9716260 CCTGCCACGTTGAGCTTGCCTGG - Intronic
901750484 1:11404115-11404137 CCTGACTCGGTGCTCTTGGCTGG - Intergenic
903273814 1:22208394-22208416 CCTGGCGGGGAGATCTTGGCAGG + Intergenic
905629814 1:39512218-39512240 CCTGCCTCAGTGACCTTGGCTGG + Intronic
905667945 1:39773972-39773994 CCTGCCTCAGTGACCTTGGCTGG - Intronic
908170156 1:61496438-61496460 CATGCCACTGAGATCTTAGATGG + Intergenic
914311828 1:146473378-146473400 CCTGCCACGGCAATCTAGCCTGG - Intergenic
918080463 1:181204017-181204039 CCTGCCTCTGAGTTCTTGGGAGG - Intergenic
919101671 1:193104563-193104585 CCTGCCACTGCGCACTTGGCCGG - Intronic
922841653 1:228647520-228647542 TCTGGAGCGGAGATCTTGGCTGG + Intergenic
1066522578 10:36238703-36238725 CCTGCCACTGAGATGTGTGCTGG - Intergenic
1066661528 10:37741640-37741662 CCTGCCACGCAAATCATGACGGG - Intergenic
1069868037 10:71516209-71516231 CCTGTCACAGAGACCTGGGCAGG - Intronic
1072318629 10:94227423-94227445 GCTGTCATGGAGTTCTTGGCTGG + Exonic
1073376356 10:103038722-103038744 CCTGCTAGGGAGGTCTGGGCCGG + Intronic
1074528159 10:114278935-114278957 CCTGCCATGGAGATTGTGACAGG + Intronic
1075075815 10:119349539-119349561 CCTCCCACACAGGTCTTGGCTGG - Intronic
1076060514 10:127410670-127410692 CCAGCCAGGGAAATGTTGGCAGG - Intronic
1077362277 11:2145983-2146005 CCTCCCACCCAGAGCTTGGCCGG + Intronic
1079987729 11:27216133-27216155 GCTGCCAGTGATATCTTGGCTGG + Intergenic
1083540490 11:63508712-63508734 CCTGCCACTGAGATCTCTGTGGG + Intronic
1084166367 11:67376503-67376525 CATCCCACGGAAATCTTGGAGGG - Intronic
1084681756 11:70670469-70670491 TCTGCCACGGTGAGCTGGGCTGG - Intronic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1092056818 12:5514224-5514246 CCAGGCCCGCAGATCTTGGCTGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1097299416 12:58002542-58002564 CCTACCAGTGAGATCTTGTCAGG - Intergenic
1102527114 12:113520055-113520077 CCAGCCGCGGGGATCCTGGCTGG + Intergenic
1103546173 12:121703210-121703232 CCTCCCAGGGAGATCCAGGCAGG - Intergenic
1104859834 12:131918202-131918224 CCTCCCAGGCAGATCTGGGCTGG + Intronic
1107181549 13:37467060-37467082 CCTGCCATGCAGTTATTGGCTGG - Intergenic
1107725174 13:43291914-43291936 CCTGTCAAAGAGCTCTTGGCTGG + Intronic
1110790546 13:79582208-79582230 CCTCCCACTGGGAACTTGGCAGG + Intergenic
1112335638 13:98513199-98513221 CCTGCCACGGACATCATGGTGGG + Intronic
1115020182 14:28670298-28670320 CCTGACAGGGACATCTTGCCTGG + Intergenic
1118321630 14:64756921-64756943 CCTGCTACGGTGATCCAGGCAGG - Intronic
1123017741 14:105383387-105383409 CCCGCCACGGCGATCTTCACGGG - Exonic
1128239855 15:66094424-66094446 CCTGCCACTGCGAGCCTGGCTGG - Exonic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1132654522 16:1036334-1036356 CCTGGCACTGAGACCTTGCCTGG + Intergenic
1132690212 16:1178727-1178749 CCTGCCCAGGAGCTCCTGGCCGG - Intronic
1132842903 16:1986941-1986963 CCTGACAGGAAGTTCTTGGCGGG + Exonic
1134875131 16:17691313-17691335 CCTGCCAGGAAGCTCTTGGATGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136867692 16:33770020-33770042 TCTGTCAGGGAGGTCTTGGCTGG - Intergenic
1141658607 16:85429627-85429649 CCAGCAAGGGAGATCTTGGGAGG - Intergenic
1203104467 16_KI270728v1_random:1346183-1346205 TCTGTCAGGGAGGTCTTGGCTGG + Intergenic
1203129047 16_KI270728v1_random:1616185-1616207 TCTGTCAGGGAGGTCTTGGCTGG - Intergenic
1142861948 17:2767629-2767651 TGTGCCTTGGAGATCTTGGCAGG + Intergenic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1151544390 17:74783667-74783689 CCTGCCTTGGAGCTATTGGCTGG - Intronic
1157485020 18:48080699-48080721 CCAGCCACTGTGAGCTTGGCTGG + Intronic
1160091913 18:75834940-75834962 ACAGCCATGGAGAGCTTGGCTGG - Intergenic
1160375762 18:78410409-78410431 TCTTCCACGGAGATCCTGCCTGG + Intergenic
1161218270 19:3105563-3105585 TCCGCCACGGAGCTCTTGGGGGG - Intronic
1161309783 19:3587105-3587127 CGTGCCAAGGAGCTCCTGGCAGG + Intronic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1165067127 19:33235883-33235905 CCTGCCAGGCCCATCTTGGCCGG + Intergenic
1166153626 19:40893822-40893844 CCTGAGACTGAGATCTTGGCAGG + Exonic
1166174770 19:41059438-41059460 CCTGAGACTGAGATCTTGGCAGG - Intergenic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
928120767 2:28582201-28582223 CCTGCCAAGGAGGTCTCAGCAGG - Intronic
931231126 2:60375780-60375802 CCTGCCCCCAAGATCATGGCTGG + Intergenic
944414377 2:199468175-199468197 GCTGTCACTGAGAGCTTGGCAGG + Intronic
947945032 2:234093869-234093891 CATGGCATGGAGTTCTTGGCAGG - Intergenic
948295702 2:236858767-236858789 GCTGCCCTGGAGATGTTGGCTGG + Intergenic
948378745 2:237539023-237539045 CCTGCCTCGCCCATCTTGGCCGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172434160 20:34916771-34916793 TCTTCCAGGGAGATCCTGGCAGG + Intronic
1172443167 20:34979639-34979661 CCTACCAGGGAGATCGTGTCAGG - Exonic
1175131718 20:56794406-56794428 CCTGCCAGGGAGATGTTTTCTGG + Intergenic
1175382945 20:58576328-58576350 CCTGCCAGGCAGTTCTGGGCTGG + Intergenic
1175780535 20:61679615-61679637 CCTGCCCCGCAGATCTTGATGGG - Intronic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1177088967 21:16742256-16742278 CCTTCCAGGGAGTTCCTGGCTGG - Intergenic
1178909710 21:36664783-36664805 GCTGGCAGGGAGATCTGGGCTGG - Intergenic
1179493279 21:41755473-41755495 CCTGCCCCTGAGCTCTTGGGTGG - Intronic
1183089425 22:35511321-35511343 CCTGCAATGGGGATCTGGGCAGG - Intergenic
1184681042 22:46072175-46072197 CCTGCCGCGGAGAGCCCGGCCGG - Intronic
953434103 3:42865083-42865105 ACTGCCACGCAGATTTCGGCGGG + Exonic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
957717111 3:83942465-83942487 CCTGCAACTGAGTTCTTGTCTGG + Intergenic
961616168 3:128182864-128182886 CCAGCCACAGAGATCGGGGCGGG + Intronic
964013788 3:151922159-151922181 CCTGCCACTGAAATCTGGACAGG - Intergenic
968435170 4:581686-581708 CCTGCAAAGGAGAACTTGGGGGG - Intergenic
969593651 4:8135950-8135972 CCTGCCACGGAGCTGCTGACAGG + Intronic
971025485 4:22585137-22585159 CCTTCCACAGACATCCTGGCAGG + Intergenic
976729288 4:88245558-88245580 CCTGGCAGGCTGATCTTGGCTGG - Intergenic
980144297 4:128962055-128962077 CCTGCCAAGGAGGTCAGGGCTGG - Intronic
990347480 5:54884221-54884243 CCTGCCCCCGAGATGTTGGGGGG - Intergenic
992888914 5:81185903-81185925 CCTGACATGGAGTTCTGGGCAGG - Intronic
996769454 5:127070852-127070874 CCTTCCAAGGAGATCTGGCCTGG - Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
999360522 5:150982366-150982388 CCTGCAAGTGAGATCTTGGTAGG - Intergenic
1003043324 6:2709774-2709796 CCTGAAAGGGAAATCTTGGCTGG - Intronic
1004697040 6:18043404-18043426 CCTGCCACGGAGCTCTGGAGGGG - Intergenic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1013512350 6:110856615-110856637 CCTGCCACAGAGTCCTTGGCAGG - Intronic
1018166998 6:161107561-161107583 CCCCTCAAGGAGATCTTGGCTGG - Intronic
1019291577 7:253061-253083 CCTGCCACGGTGGCCTGGGCTGG + Intronic
1020135711 7:5586755-5586777 CCTGGCAGGGACATCTTGGCAGG + Intergenic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1024257691 7:47550665-47550687 CCTTCCACGTAGATCTTTCCAGG - Intronic
1031720163 7:125164657-125164679 CATGCGAGGGAGATCATGGCAGG + Intergenic
1038350063 8:26768002-26768024 TCTGGCACTGAGATGTTGGCCGG - Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1040569218 8:48592918-48592940 CCTGCCCCGGGGATGTTGGTAGG + Intergenic
1047401727 8:124553847-124553869 CCTGCCACGGAGTTCTTAGTTGG - Intronic
1049577899 8:143398093-143398115 CCTGCCCCTGAGTTCTTGGGTGG - Intergenic
1050151881 9:2624834-2624856 ACTGCCAAGGAGGGCTTGGCTGG - Intronic
1053302520 9:36962048-36962070 CCACCCAGGTAGATCTTGGCGGG + Intronic
1055490389 9:76798989-76799011 CCTGCCAGGGTGATCTGGACTGG - Intronic
1061590461 9:131594486-131594508 CCTGCCAAGCAGGGCTTGGCAGG - Intronic
1185461389 X:334178-334200 CCTGGCACAGAGCTCTGGGCAGG + Exonic
1185558654 X:1041260-1041282 ACAGCCCCGGAGATCTTGGCTGG - Intergenic
1185809142 X:3088871-3088893 CCTTCCAAGGAGTTCTGGGCTGG + Intronic
1188519538 X:31022357-31022379 CCTGCCACTTAAAGCTTGGCTGG + Intergenic
1192244632 X:69362301-69362323 CTTGCCCCGGACATCTTTGCTGG - Intergenic
1202091094 Y:21191300-21191322 CATGCCACAGAGAACTGGGCAGG - Intergenic