ID: 955061294

View in Genome Browser
Species Human (GRCh38)
Location 3:55493671-55493693
Sequence ACTTTTGCTCAGCAGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955061294_955061300 11 Left 955061294 3:55493671-55493693 CCATGCCACTGCTGAGCAAAAGT No data
Right 955061300 3:55493705-55493727 TAATCTGACTTTAAATGTAAGGG No data
955061294_955061299 10 Left 955061294 3:55493671-55493693 CCATGCCACTGCTGAGCAAAAGT No data
Right 955061299 3:55493704-55493726 GTAATCTGACTTTAAATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955061294 Original CRISPR ACTTTTGCTCAGCAGTGGCA TGG (reversed) Intergenic
No off target data available for this crispr