ID: 955061294 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:55493671-55493693 |
| Sequence | ACTTTTGCTCAGCAGTGGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955061294_955061300 | 11 | Left | 955061294 | 3:55493671-55493693 | CCATGCCACTGCTGAGCAAAAGT | No data | ||
| Right | 955061300 | 3:55493705-55493727 | TAATCTGACTTTAAATGTAAGGG | No data | ||||
| 955061294_955061299 | 10 | Left | 955061294 | 3:55493671-55493693 | CCATGCCACTGCTGAGCAAAAGT | No data | ||
| Right | 955061299 | 3:55493704-55493726 | GTAATCTGACTTTAAATGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955061294 | Original CRISPR | ACTTTTGCTCAGCAGTGGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||