ID: 955064673

View in Genome Browser
Species Human (GRCh38)
Location 3:55524172-55524194
Sequence TGTATGGGCGAGTATAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955064673_955064681 -3 Left 955064673 3:55524172-55524194 CCCCCTCTATACTCGCCCATACA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299
955064673_955064678 -10 Left 955064673 3:55524172-55524194 CCCCCTCTATACTCGCCCATACA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 955064678 3:55524185-55524207 CGCCCATACAGCAGAGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955064673 Original CRISPR TGTATGGGCGAGTATAGAGG GGG (reversed) Intronic
900726317 1:4218633-4218655 TGGATGGGCCAGTCTAGAGGTGG + Intergenic
901151135 1:7102584-7102606 TGTATGCGCAAGGATGGAGGAGG + Intronic
901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG + Intergenic
902051272 1:13565359-13565381 TTTATTGGACAGTATAGAGGTGG - Intergenic
908342069 1:63191808-63191830 GGTATAAGCAAGTATAGAGGGGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1073187767 10:101626960-101626982 TGGGTGGGCCAGAATAGAGGAGG - Intronic
1084093793 11:66896802-66896824 TGTATGTGCGTATATATAGGCGG - Intronic
1084829809 11:71760230-71760252 TGAATGGGGGAGTAGTGAGGTGG - Intergenic
1085016991 11:73180350-73180372 AGTTTGGGGGAGTATGGAGGAGG + Intergenic
1085212378 11:74792573-74792595 TGTATTTGTGAGTAGAGAGGGGG + Intronic
1086667646 11:89503265-89503287 TGTATGGGAGAGTCTAGTTGAGG - Intergenic
1091436544 12:477949-477971 TGTTTGGAAGATTATAGAGGGGG + Intronic
1093167507 12:15821938-15821960 TGTATGGGCAACTATGGAGAGGG - Intronic
1095384240 12:41631391-41631413 TGTATGGGGGAGGACAGAGGAGG + Intergenic
1100120807 12:91367361-91367383 AGCATGGGTGGGTATAGAGGTGG - Intergenic
1102676513 12:114663200-114663222 AGTATGGGGTAGAATAGAGGTGG + Intergenic
1102927764 12:116839639-116839661 TGGATGGGTGAGTGTAAAGGTGG + Intronic
1110127497 13:71964758-71964780 TGAAGGGGCAGGTATAGAGGAGG - Intergenic
1112585582 13:100716047-100716069 TTTATGGGTGATCATAGAGGAGG - Intergenic
1113340285 13:109416284-109416306 TGGATGGGCGGGTGAAGAGGAGG - Intergenic
1118554021 14:66993254-66993276 TGTATGTGTGTGTGTAGAGGGGG - Intronic
1125318482 15:38457683-38457705 TGTAATGGCAAGAATAGAGGTGG + Intronic
1137492944 16:48948288-48948310 TGTCTGGCCGAGCACAGAGGTGG - Intergenic
1137574896 16:49593059-49593081 TGTATGGGGGAGTGAAGAGAAGG + Intronic
1151006582 17:70444451-70444473 AGTATGGGGTAGTAGAGAGGAGG + Intergenic
1165229124 19:34375604-34375626 TGTATGGGACACTTTAGAGGGGG - Intronic
926331618 2:11830208-11830230 TGTATGGCGGAGTTTGGAGGGGG + Intergenic
931747880 2:65306770-65306792 TTTATTGGGGAGTAGAGAGGGGG - Intergenic
1169540016 20:6589783-6589805 TTTGTGGGCGAGTATCCAGGGGG - Intergenic
1171345273 20:24461297-24461319 TGCATGTGCGAGTATGAAGGCGG - Intergenic
1173106900 20:40145259-40145281 AGTATGGAGGGGTATAGAGGGGG - Intergenic
1173622570 20:44448079-44448101 TGTATGGGTTGGTATAGAGTTGG + Intergenic
1173761213 20:45562221-45562243 TGTATGGATGAGAAGAGAGGTGG + Intronic
1174097906 20:48104134-48104156 TGTATGAGAGAGGAGAGAGGAGG + Intergenic
1182727623 22:32460543-32460565 TGGATGGTGGGGTATAGAGGGGG - Intronic
1182734396 22:32521054-32521076 TGTATAGGCGAGTAGATGGGAGG + Intronic
1185414391 22:50701789-50701811 TATATGGGCGGGCTTAGAGGGGG + Intergenic
950294615 3:11818187-11818209 TGTCAGGGGGAGTAGAGAGGTGG + Intronic
952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG + Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
963855010 3:150244420-150244442 TGTAAGGGATGGTATAGAGGTGG + Intergenic
964716021 3:159722606-159722628 TGTATGTGTGTGTATAGAGAGGG + Intronic
979414961 4:120425667-120425689 AGTATGGGCCAGAAGAGAGGGGG + Intergenic
984831837 4:183983174-183983196 AGGATGGGCGAGTAAAGGGGTGG - Intronic
991360822 5:65818377-65818399 TGTATGGGGGGGTAGAGAAGTGG - Intronic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1008541103 6:52547046-52547068 TGTATGGGTGAGCATGGAGTGGG + Intronic
1012328893 6:97959527-97959549 TGGATGGCAGAGTATACAGGAGG + Intergenic
1021571369 7:22068473-22068495 TTTATGGGGGTGGATAGAGGTGG + Intergenic
1029701707 7:102250749-102250771 TATATGCGTGAGAATAGAGGCGG + Exonic
1032095252 7:128935033-128935055 TGTGTGAGCGAGTGTAGAGTGGG - Intergenic
1032188272 7:129746453-129746475 GGTATGTGCCAGTATAGAAGTGG - Intronic
1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG + Intronic
1037980443 8:23249731-23249753 TGAGTGGGCCAGTTTAGAGGTGG - Intronic
1041752629 8:61277505-61277527 TCTATGGGTGAGTATAGGGGAGG + Intronic
1052196817 9:25727431-25727453 TGGAAGTGCGAATATAGAGGAGG - Intergenic
1055716556 9:79124358-79124380 TGTATGTGTGTGTATTGAGGAGG - Intergenic
1191784593 X:64903776-64903798 TATATTGGCCAGTATAGGGGAGG - Intergenic
1196750316 X:119110452-119110474 TGTATGGGAGATTATAGACCGGG + Intronic
1199392614 X:147298350-147298372 TGTATGTGTGTGTATAGAGATGG - Intergenic
1201530470 Y:14985566-14985588 TGTGTGGGGGAGATTAGAGGAGG - Intergenic