ID: 955064678

View in Genome Browser
Species Human (GRCh38)
Location 3:55524185-55524207
Sequence CGCCCATACAGCAGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955064673_955064678 -10 Left 955064673 3:55524172-55524194 CCCCCTCTATACTCGCCCATACA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 955064678 3:55524185-55524207 CGCCCATACAGCAGAGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 74
955064672_955064678 1 Left 955064672 3:55524161-55524183 CCTTATTATCTCCCCCTCTATAC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 955064678 3:55524185-55524207 CGCCCATACAGCAGAGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955064678 Original CRISPR CGCCCATACAGCAGAGAGCT GGG Intronic
901225561 1:7611127-7611149 GGGCCATGCAGAAGAGAGCTGGG + Intronic
907446624 1:54512277-54512299 CGTCTTTAAAGCAGAGAGCTGGG - Intergenic
908516631 1:64898765-64898787 TGGACATACATCAGAGAGCTTGG - Intronic
911375662 1:97047588-97047610 CTCACCAACAGCAGAGAGCTGGG - Intergenic
915510919 1:156386535-156386557 GGCCCATGCAGAACAGAGCTGGG - Intergenic
915674513 1:157517928-157517950 CCCCCACACAGCAGAGAGAGAGG - Intronic
916428028 1:164700268-164700290 AGCCTGTACATCAGAGAGCTTGG + Intronic
920837974 1:209529639-209529661 AGCCCATCAAGAAGAGAGCTGGG + Intergenic
1067385609 10:45815503-45815525 CACCCATGCAGCAGAGAGTCTGG - Exonic
1071610163 10:87024635-87024657 CACCCATGCAGCAGAGAGTCTGG + Exonic
1072346547 10:94513350-94513372 CTCCCAGACAGCAGTGAGCTAGG + Intronic
1078150974 11:8759424-8759446 CGGCTATAAAGCAGAGTGCTGGG - Intronic
1084611007 11:70203088-70203110 CGCCCTCACCGCAGAGAGCTGGG + Intergenic
1085298770 11:75446137-75446159 AGCCCATGCAGCAGGGAGCGTGG - Intronic
1091447221 12:550978-551000 AGCCCATCCACCAGATAGCTGGG - Exonic
1093426075 12:19030901-19030923 CACCCAAAGAACAGAGAGCTAGG + Intergenic
1096596095 12:52696491-52696513 CCTCCTTACAGCAGAAAGCTTGG + Intronic
1103916694 12:124379463-124379485 CGCATAGACAGCAGAGAGCAGGG + Intronic
1107675301 13:42790210-42790232 CCCTCATAAAGCAGAGAGGTTGG + Exonic
1108730074 13:53225870-53225892 CACCTAAACAGCAGAGTGCTAGG - Intergenic
1117406673 14:55411260-55411282 AGTACATACAGCAAAGAGCTGGG + Intronic
1122417451 14:101557204-101557226 CGCACCTGCAGCAGTGAGCTGGG - Intergenic
1122648269 14:103209406-103209428 CACCACGACAGCAGAGAGCTGGG + Intergenic
1124599134 15:31116993-31117015 CTCAGATACAGCAGAGAGTTTGG + Intronic
1129683507 15:77671617-77671639 CCCCCATGCAGCAGTGAGGTGGG + Intronic
1133988651 16:10688276-10688298 TACCCATAGAGCAAAGAGCTTGG - Intronic
1141019506 16:80481935-80481957 TGCCCATAAAGGAGTGAGCTCGG + Intergenic
1141696243 16:85621030-85621052 CCCCCACACAGCAGAGACCCAGG - Intronic
1143261603 17:5603318-5603340 CCCCCATAAAACTGAGAGCTTGG + Intronic
1143288863 17:5813398-5813420 CCCAGATACAGCAGAGAGCAGGG - Intronic
1152576360 17:81143032-81143054 CGCCTACTCAGCACAGAGCTGGG + Intronic
1153290239 18:3494199-3494221 CTCCCATAAAGCATAGAGATGGG - Intergenic
1154099525 18:11457421-11457443 CGCCCATTCATCACAGAGCATGG - Intergenic
1159005485 18:63006439-63006461 CGCCAATACACAGGAGAGCTTGG - Intergenic
1159991327 18:74912149-74912171 AAACCAAACAGCAGAGAGCTTGG - Intronic
1164809706 19:31146602-31146624 TGCCCATAAAGCAGAGTGCTAGG - Intergenic
1167457235 19:49603054-49603076 TTCCCATATGGCAGAGAGCTGGG + Intronic
928088205 2:28358838-28358860 AGACCATAAAGCACAGAGCTTGG + Intergenic
930079326 2:47433615-47433637 CGCCCAGCCAGGAGAGAGGTGGG - Intronic
934070156 2:88376619-88376641 CACCCATACTGCAGAGGGATGGG - Intergenic
1175516411 20:59573238-59573260 CTCCCAGACAGCAGAAAGATTGG + Intergenic
1179958950 21:44757705-44757727 AGACCACACAGTAGAGAGCTGGG + Intergenic
1179960912 21:44766617-44766639 CGCCCACCCAGCAGAGGGCAGGG + Intergenic
1180200380 21:46220559-46220581 TGCGCATGCAGCAGAGAGCAGGG + Intronic
1180867885 22:19129916-19129938 CACCCAGGCAGCAGAGAGCCTGG - Intergenic
1185194895 22:49462992-49463014 AGTCCGTGCAGCAGAGAGCTGGG - Intronic
950490594 3:13302359-13302381 AGCCCATCCAGCAGAGGGCAGGG + Intergenic
954862909 3:53705151-53705173 GGCTCACACAGCAGAGTGCTGGG - Intronic
955064678 3:55524185-55524207 CGCCCATACAGCAGAGAGCTGGG + Intronic
960703679 3:120461421-120461443 GGACCATTCAGAAGAGAGCTGGG - Intergenic
961209542 3:125115176-125115198 CACACATACACCTGAGAGCTGGG + Intronic
961528257 3:127522611-127522633 CGCCAACTCACCAGAGAGCTGGG - Intergenic
963045666 3:141101017-141101039 CTCCCAGACAGCAGAGGGCTGGG + Intronic
963299728 3:143584979-143585001 CGCCCATAAAGAGGAGAGCTGGG - Intronic
967258514 3:187618667-187618689 AGACAATACAGCAAAGAGCTGGG - Intergenic
984836988 4:184031653-184031675 CGCCCATACTGCAACGTGCTCGG + Intergenic
984837368 4:184034157-184034179 GGCCCCTACAGCTCAGAGCTGGG + Intergenic
986521780 5:8627201-8627223 CCCCCATGCTGCAGTGAGCTTGG + Intergenic
994349257 5:98725595-98725617 GGCCCATAGAGCGGATAGCTAGG - Intergenic
996691481 5:126345068-126345090 AGCACAGACTGCAGAGAGCTTGG - Intergenic
1000123708 5:158223201-158223223 CGACTAGACAGCAGAGAGCTGGG - Intergenic
1002417993 5:179130689-179130711 CCCCCACACTGCAGAGAGCATGG - Intronic
1004490693 6:16112071-16112093 GGCCCTTTCAGCAGAGAGCTAGG - Intergenic
1006506865 6:34494826-34494848 TGCCTATACAGCCGATAGCTGGG - Intronic
1006511149 6:34521886-34521908 AGCCCATACATGAGAGAGCCAGG + Intronic
1011920992 6:92577231-92577253 TGACCATACAGCAGAGAGGGTGG - Intergenic
1012283284 6:97356666-97356688 CCCCCATGCAGCAGAGAGTATGG - Intergenic
1014458043 6:121660702-121660724 GACCCAAACAGCAGCGAGCTTGG - Intergenic
1015933537 6:138385816-138385838 TGCGCATCCAGCAGAGAGCAAGG - Intergenic
1024941421 7:54767301-54767323 TGGCCACACAGCAGAGAGCAAGG - Intergenic
1029546258 7:101212063-101212085 CACCCAGACAGCAGAGAGCCTGG - Intronic
1031226027 7:119038934-119038956 AGCACATACAGCAGAGAGGAAGG - Intergenic
1033511474 7:142064213-142064235 CGCCAATGCAGCTCAGAGCTGGG + Intronic
1042110805 8:65379550-65379572 GGCCCAAACAGCAGACATCTGGG + Intergenic
1043504211 8:80886463-80886485 CAGCCCTACAGCAGAGAGATGGG - Intergenic
1051882031 9:21849747-21849769 GGCCCATACAGAAGACAGATGGG + Intronic
1051978101 9:22979050-22979072 AGCCCTCTCAGCAGAGAGCTGGG - Intergenic
1059438185 9:114288862-114288884 GGCCCATCCTGCAGAGGGCTGGG - Intronic
1059734618 9:117088835-117088857 AACCCATACAGCACAGAGCTGGG + Intronic
1060662422 9:125412086-125412108 GCCCCAGACAGCAGAGAGATGGG + Intergenic
1061325461 9:129861269-129861291 AGACCATACAGCAGAGGGGTCGG - Intronic
1186452360 X:9684210-9684232 CCCCCAAACAGCAGAGCCCTGGG + Intronic
1190332352 X:49243476-49243498 AGCCCAGACAGCAGGGAGCCAGG - Intronic
1200761492 Y:7043147-7043169 CCCCCAAACAGCAGAGCCCTGGG + Intronic