ID: 955064681

View in Genome Browser
Species Human (GRCh38)
Location 3:55524192-55524214
Sequence ACAGCAGAGAGCTGGGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955064676_955064681 -6 Left 955064676 3:55524175-55524197 CCTCTATACTCGCCCATACAGCA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299
955064674_955064681 -4 Left 955064674 3:55524173-55524195 CCCCTCTATACTCGCCCATACAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299
955064675_955064681 -5 Left 955064675 3:55524174-55524196 CCCTCTATACTCGCCCATACAGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299
955064673_955064681 -3 Left 955064673 3:55524172-55524194 CCCCCTCTATACTCGCCCATACA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299
955064672_955064681 8 Left 955064672 3:55524161-55524183 CCTTATTATCTCCCCCTCTATAC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG 0: 1
1: 1
2: 4
3: 24
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955064681 Original CRISPR ACAGCAGAGAGCTGGGCAAT AGG Intronic
900313483 1:2045987-2046009 ACAGCAGTGAGCTGGCCAGGCGG - Intergenic
900375723 1:2353748-2353770 ACAGCAGGGTGCTGGGCAGAGGG - Intronic
900681982 1:3921571-3921593 ACAGCACAGTGCTGGGCACTTGG + Intergenic
900798983 1:4726170-4726192 CCTGCAGAGAGCTGGGCACAGGG + Intronic
900872245 1:5312361-5312383 ACAGCAGAGGGCTGGAGCATGGG - Intergenic
901019114 1:6247001-6247023 ACAGAACAGGGCAGGGCAATAGG - Intergenic
901530063 1:9847089-9847111 CCAGCAGAGAGCTTGGAAACCGG - Intergenic
901796404 1:11681750-11681772 CCAGCCGAGTGCTGGGCACTGGG + Exonic
902096803 1:13952432-13952454 CCAGCACAGGGCTGGACAATTGG + Intergenic
902877978 1:19352465-19352487 ACAGCAGAGACGTGGGAAAGAGG - Intronic
904201175 1:28820066-28820088 TCAGCACAGAGCTAGGCATTTGG + Intronic
904612703 1:31734044-31734066 AAAGCAGAGAGATGGGCAGGGGG + Intronic
906476577 1:46173371-46173393 ACAGCAGTGAGCAAGGCAGTGGG - Intronic
906538765 1:46568806-46568828 AGAGCAGAGAGCTCTGCAAACGG + Intronic
906683477 1:47747287-47747309 ACATCTGAGATCTGGCCAATGGG + Intergenic
906930307 1:50163165-50163187 ACAGGAGACAGCCAGGCAATAGG - Intronic
907554112 1:55329656-55329678 ACAGCAGTGAGCAGGTCAGTGGG + Intergenic
907673773 1:56499956-56499978 ACAGCAGAGATCTGTGGAGTAGG - Intronic
908423594 1:63983405-63983427 GCTGCTGAGAGATGGGCAATAGG + Intronic
909358165 1:74732486-74732508 ACAGCTGAGAGCTGGGCTGTGGG + Intronic
911475604 1:98368278-98368300 CCAGCAGATTGCTGGGCAAAAGG - Intergenic
912249130 1:107992749-107992771 ACATCAGAGAGCTGGTAAGTAGG + Intergenic
912261812 1:108118381-108118403 TCAGGAGAGAGCTGTGCAATGGG + Intergenic
912341306 1:108918551-108918573 CCAGAAGAGAGCTGGGGATTTGG + Intronic
912392780 1:109316159-109316181 AGAGAAGAGCACTGGGCAATAGG - Intronic
912509944 1:110182527-110182549 AGAGAAGAGAGCTGAGCACTGGG + Intronic
912723969 1:112042852-112042874 ACTGCAGAGACCAGGGGAATGGG + Intergenic
915227725 1:154423023-154423045 ACAGGGGAGGGCTGGGCTATGGG + Intronic
915333672 1:155128527-155128549 TCAGGAGAGAGCTGGGCTGTAGG + Intronic
915899202 1:159834324-159834346 CCAGCAGAGAGAAGGGCAAGAGG + Intronic
916025486 1:160829999-160830021 ACAGCAGAGAACTAGACACTAGG - Intergenic
916492495 1:165314248-165314270 AAAGCAGAGAGCATGGCAAAGGG + Intronic
917217241 1:172691098-172691120 ACAGGAGAAAGCTCTGCAATAGG - Intergenic
917444739 1:175097687-175097709 ACAAAAGAGAGATGGTCAATTGG + Intronic
918043062 1:180924933-180924955 TTAGCACAGAGCTGGGCACTTGG - Intronic
919197145 1:194300500-194300522 ACAGAGGAGAGCTTGGCAGTTGG - Intergenic
919667982 1:200310788-200310810 GATGCAGAGAGCTGGGCTATGGG - Intergenic
920171282 1:204073751-204073773 ACTTCAGAGAGCTGGGGAAATGG - Intronic
920747790 1:208645180-208645202 ACAGCAGAGTCATGGGCAATGGG + Intergenic
920983662 1:210863233-210863255 CCAGCAGAGTGTTGGGCACTAGG + Intronic
921757580 1:218877981-218878003 CCAGAAGAAAGCTGAGCAATTGG - Intergenic
922405463 1:225308076-225308098 GCAGCTGAGAGCTGGCCAAATGG + Intronic
924816021 1:247442872-247442894 ACTGCAGTGAGCTGTGCACTTGG + Intronic
1063264994 10:4438269-4438291 ACTGCAGAGAGCTCCGGAATTGG + Intergenic
1065209496 10:23389095-23389117 ACAGGAGAGAGAAGTGCAATGGG + Intergenic
1066438808 10:35418189-35418211 ACAGCAGGGAGCAGGGAAGTAGG + Intronic
1066455584 10:35568907-35568929 CCAGCAGAGAGCTGGGCTCTGGG + Intronic
1067384417 10:45805608-45805630 TCACCAAAGAGCTGGGTAATGGG - Intergenic
1067892110 10:50146169-50146191 TCACCAAAGAGCTGGGTAATGGG - Intergenic
1068021867 10:51595284-51595306 ACTGCAGTGACCTGGGCAAGAGG + Intronic
1071326429 10:84523273-84523295 GCTGCTGAGAGCTGGGCAACTGG - Intergenic
1073131951 10:101195332-101195354 AGAGCTGAGAGGTGGGGAATAGG + Intergenic
1073515903 10:104075284-104075306 TCGCCAGAGAGCTGGGCAAGTGG + Intronic
1075365283 10:121882513-121882535 AGTGAAGAGAGCTGAGCAATTGG + Intronic
1076611052 10:131726103-131726125 ACAGCAGAGAGCTGGTGAGAAGG + Intergenic
1077241202 11:1511241-1511263 ACAGAAGACAGCGGGGCCATGGG + Intergenic
1077273275 11:1691790-1691812 CCAGCAGTGAGATGGGCCATGGG - Intergenic
1078361661 11:10674095-10674117 ACTGCACAGAGCTTGGCACTTGG - Intronic
1079582710 11:22086323-22086345 ACTGAAGAGAGCTGGGAAGTGGG + Intergenic
1081737427 11:45413826-45413848 CCAGGAGAGATCTGGGCATTGGG - Intergenic
1082655365 11:55849157-55849179 ATAGCAGAGAGCTGGAGAATGGG + Intergenic
1082796424 11:57381277-57381299 CCAGCAGAGAGCAGGGCACAGGG - Intergenic
1088194616 11:107261078-107261100 AAAGCTGAGACCTGAGCAATCGG - Intergenic
1089343709 11:117776937-117776959 ACTGCAGAGAGATTGGCAGTGGG + Exonic
1089572835 11:119421853-119421875 ACTCCAGAGAGCTGGACATTGGG - Intronic
1090710726 11:129382602-129382624 CCAGCTGAGAGCTTGTCAATGGG - Intronic
1091349438 11:134881298-134881320 ACAGCAGGGAGGTGGGGAAGGGG - Intergenic
1092392853 12:8096616-8096638 ACAGCAGAGACCCAGGAAATAGG - Exonic
1092905316 12:13095843-13095865 ACACCAGAGAGCTTGCCAATGGG + Intronic
1093555405 12:20467634-20467656 ACAGTAAAGAGTTGGTCAATGGG + Intronic
1094102496 12:26779052-26779074 ACAGCAGAAAGCTCTGCAACAGG + Intronic
1094211898 12:27901676-27901698 ACAAAAGAGAGCTGGGACATGGG - Intergenic
1096220313 12:49824928-49824950 ATAGCAGAAAGCTGGGCCCTTGG - Intronic
1098151041 12:67546932-67546954 TCAGAAGAGAGCTGCACAATAGG - Intergenic
1100267860 12:92995401-92995423 ACAGCAGAGATTTGGGGAAGTGG - Intergenic
1100709112 12:97235085-97235107 ACTCCAGGGAGCTGGGCAAAGGG - Intergenic
1102152936 12:110701050-110701072 AGAGCAGAGAGCAGGGCCACAGG + Intronic
1102655748 12:114480972-114480994 GCAGCGGAGAGCTGGGGAAGGGG + Intergenic
1104704540 12:130933605-130933627 AGACCAGAGAGCTGGGGAACGGG + Intergenic
1105709349 13:22991547-22991569 ACAGCAGAGAAGTTGGCACTAGG + Intergenic
1106299480 13:28451064-28451086 ACAGCAGAGAGCTAAGCAGAGGG - Intronic
1106444781 13:29817805-29817827 AGAGCAGGGAGCTGGGTAAATGG + Intronic
1106784583 13:33093891-33093913 AAAGGAAAGAGATGGGCAATGGG - Intergenic
1107670527 13:42742315-42742337 ACAGTAGAGATGTGGGCAAAAGG + Intergenic
1107785027 13:43946966-43946988 ACAGAGGAGAGCTGGGCAGATGG + Intergenic
1109429010 13:62207660-62207682 AAGGAAGAGAGCTGGTCAATAGG - Intergenic
1111906554 13:94262141-94262163 TCAGCACAGAGCTGGGCATATGG + Intronic
1112559227 13:100497124-100497146 ATAGCAGAGAAATGGGGAATTGG + Intronic
1112562089 13:100524041-100524063 ACACCAGGGAGCTGGGCAGTGGG - Intronic
1113614690 13:111671797-111671819 AGAGCACAGAGCTGGGCCAGTGG + Intronic
1113620159 13:111756711-111756733 AGAGCACAGAGCTGGGCCAGTGG + Intergenic
1117605249 14:57422333-57422355 ACCCCAGAGAGCTGGGCAGCTGG - Intergenic
1120678764 14:87453776-87453798 ACAGAAGAGGCCTGGGCAGTGGG - Intergenic
1121167349 14:91818013-91818035 ACAGCAAAGAACTGAGAAATAGG + Intronic
1121217571 14:92260477-92260499 ACAGGTCAGAGCTGGGCAGTAGG - Intergenic
1121502317 14:94448055-94448077 ACAGCAGAGAGCCAGCTAATAGG - Intronic
1122714289 14:103684640-103684662 ACAGCTGACAGCTGGGCAATGGG - Intronic
1124553486 15:30705325-30705347 CCATCAGAGAGCAGGGCAAAGGG + Intronic
1124677759 15:31700343-31700365 CCATCAGAGAGCAGGGCAAAGGG - Intronic
1124715996 15:32062365-32062387 ACAGCTGAGAGCCATGCAATAGG + Intronic
1127658708 15:61080061-61080083 ACAGAAGAGAGCTGGTTCATGGG + Intronic
1127731647 15:61807526-61807548 AAGGCAGAGAGCTTGGTAATTGG + Intergenic
1127801521 15:62481422-62481444 ACTGCAGTGAGCTGGGTGATGGG - Intronic
1129165149 15:73772858-73772880 ACAGCAGAGAGCTCCTCAGTAGG - Intergenic
1129296428 15:74602685-74602707 AGAGCTGAGAGCTGAGCAGTGGG - Intronic
1129383154 15:75180539-75180561 CCAGCAGAAAGCTGGGCAGAGGG + Intergenic
1131804802 15:96110066-96110088 CCAGCAGAGAGCTGGGTCCTTGG + Intergenic
1132109275 15:99090400-99090422 GAAACAGACAGCTGGGCAATGGG - Intergenic
1132235403 15:100216429-100216451 ACAGCAAAGAGCTGGGGACTGGG + Intronic
1132806097 16:1775831-1775853 ACAGCAGGGCGCTGGGCAGCCGG + Exonic
1132860812 16:2070894-2070916 GCAGCAGAGGGCTGGGCAGGTGG + Intronic
1135887423 16:26323379-26323401 ACAGCAGGGAGCGGGGGAAGAGG + Intergenic
1136491601 16:30612007-30612029 AAAGCATAGTGCTAGGCAATTGG + Intronic
1136599457 16:31275111-31275133 ACAGCAGAGTGCTGGGGGAAAGG + Intronic
1136670786 16:31855113-31855135 ACAGCAGTGGGCTAGGAAATGGG - Intergenic
1137364482 16:47848923-47848945 GCAGCAGGGAGCAGGGAAATGGG - Intergenic
1137572617 16:49576628-49576650 GCAGCAGAGAGTTGGGCTCTGGG - Intronic
1139364984 16:66427486-66427508 ACCGCAGAGCGCGGGGGAATGGG - Intronic
1139483737 16:67244985-67245007 ACATCAGAGAGCTGAGCAAGGGG - Intronic
1140408558 16:74727131-74727153 ACAGCATAGACCTGGGCTCTGGG + Intronic
1141184167 16:81775229-81775251 AAAGCAGAGAGCGGGCCTATCGG - Intronic
1142068066 16:88074056-88074078 AAGGCAGAGAGCTGGGCCCTTGG - Intronic
1142248026 16:88978700-88978722 ACTGCACACAGCTGGGGAATAGG - Intergenic
1142608835 17:1096844-1096866 CCAGGAGAGAGCTGGGGAATGGG + Intronic
1143295529 17:5868920-5868942 ACAGGAGAGACCTTGGCAAGTGG + Intronic
1143902375 17:10183930-10183952 GCAGCAGAGTGCTTGGCAAGAGG - Intronic
1146514231 17:33476652-33476674 GCAGCTGAGAGCTGGCCAAATGG + Intronic
1146976241 17:37114677-37114699 ACTTCAGTGAGCTGGGAAATGGG - Intronic
1147353982 17:39876356-39876378 AAAGCAGAGAACTAGGAAATAGG + Intronic
1148214721 17:45828208-45828230 TCTGCAGAGAGCTGGGCATGGGG + Intronic
1149298844 17:55285712-55285734 ACAGCAGAGAGCTGGGCACTGGG + Intronic
1149538761 17:57452871-57452893 ACAGCTGAGAGGTGGGGAACTGG + Intronic
1150235818 17:63591977-63591999 CCACCAGAGAGCTGGAGAATGGG + Exonic
1150251541 17:63707492-63707514 ACAGGAGAGAGCTGGCCAGGTGG - Intronic
1150523514 17:65895294-65895316 CCAGCAGAGAGCTTGGCACATGG + Intronic
1151572675 17:74935137-74935159 ACAGCAGAGAGATGGGAAGGAGG + Intergenic
1152885384 17:82846274-82846296 GCAGCAGAGGGCTGGACAAGAGG - Intronic
1153558215 18:6340562-6340584 ACAGCTGAGAGCATGGCAAAGGG + Intronic
1155136497 18:22999343-22999365 ACAGCAGAGGGCTGGGCAGCTGG + Intronic
1156493861 18:37512955-37512977 ACAGCAGAGAGCTGGAGAATGGG + Intronic
1156655201 18:39276678-39276700 AGAGCAGAGTACTTGGCAATGGG - Intergenic
1157582029 18:48779214-48779236 ACTGCAGAGAGCTGGCCCAATGG - Intronic
1158419501 18:57280207-57280229 ACAGCATAGAGCTGGGCTCTGGG - Intergenic
1158579678 18:58671102-58671124 ACGCCAGAGAGCGGGGCAAGCGG - Intergenic
1159711278 18:71763910-71763932 ACAGGAGAAAGCTCTGCAATAGG + Intronic
1159711968 18:71772070-71772092 ACAGTAGAAAGCTGGAGAATGGG + Intronic
1160132138 18:76234989-76235011 ACATCAGGGAGATGGGAAATTGG - Intergenic
1160435119 18:78845677-78845699 ACAGCAGCCAGGTGGGCAAAGGG - Intergenic
1162001941 19:7750391-7750413 ACAGCAGAGACAGTGGCAATTGG + Intergenic
1162139314 19:8576484-8576506 ACAGCAGAGAGCTGTGGGGTGGG + Intronic
1163850615 19:19661176-19661198 AGAGCAGAGCCCTGGGCATTAGG - Intronic
1166086493 19:40479072-40479094 CCATGAGAGAGCTGGGCAAAGGG - Intronic
1166328405 19:42065206-42065228 ACACCAGTGAGCGGGGCCATGGG - Exonic
1166643544 19:44514278-44514300 GCAGAAGTGAGATGGGCAATCGG - Intronic
1167320830 19:48796401-48796423 GCTGCAGGGAGCTGGGGAATGGG - Intronic
1167781619 19:51602108-51602130 CCAGCAGAGAACTGGGCAGGAGG - Intergenic
1167898441 19:52600785-52600807 ACAGCAGAGATGCGGGCACTGGG - Intronic
1168308558 19:55449866-55449888 GCAGCACAGAGCTGGGCAGGGGG - Intergenic
925719989 2:6817718-6817740 AAAGCAGAGAGCTGTGCAGGTGG + Intergenic
926235689 2:11041684-11041706 ACAGCAGACAACTGAGCAGTGGG + Intergenic
927640718 2:24843882-24843904 TCAGCAGGGAGCTGGTCAAGAGG + Intronic
928324663 2:30309945-30309967 ACAGCACAGAGCTTGGCACAGGG - Intronic
930029452 2:47049369-47049391 GCAGCAGGGATCTGGGAAATTGG + Intronic
932580137 2:72988072-72988094 TCAGCACAGAGCTGGTCAGTGGG + Intronic
932851800 2:75194903-75194925 CCTGCAGGGAGCTGGGGAATGGG - Intronic
932862775 2:75311920-75311942 ACAGTAGAGAACTGGACATTTGG + Intergenic
933993272 2:87649020-87649042 AAAGCAGAGTGCTGGGGACTTGG - Intergenic
935858377 2:107299834-107299856 ACTGCAGAGTGCTGGACAGTGGG - Intergenic
936300585 2:111301863-111301885 AAAGCAGAGTGCTGGGGACTTGG + Intergenic
936491372 2:112975374-112975396 CCAGCAGAGAGCTCTGCATTTGG + Intronic
937934575 2:127232523-127232545 AGAGCAGAGAGTTGGGCTACAGG + Intergenic
938341462 2:130539255-130539277 TCAGCTGAGAGCTGGCCCATGGG + Exonic
940909819 2:159200804-159200826 ACAGCTGAGAGCTTGGAAGTGGG - Intronic
942193359 2:173493253-173493275 ACAGCACAGTGATGGGCAACTGG + Intergenic
943531175 2:189082917-189082939 AAAGCAGGGAGTTGGGAAATTGG + Intronic
946183915 2:217966039-217966061 AGAGCAGAGAGAAGGGCAAATGG - Intronic
946563816 2:220941382-220941404 CCAGCAGAGAACTGGGAAGTAGG - Intergenic
946873568 2:224106635-224106657 ACAAGAGAAAGCTGGGCAATAGG - Intergenic
948203254 2:236145113-236145135 ACAGCAGAGACCTGAACAACAGG + Intergenic
1169378752 20:5088449-5088471 TCAGCAGAAGGGTGGGCAATGGG + Intronic
1169950824 20:11041376-11041398 CCAGCAGAGAACTGTGCATTGGG + Intergenic
1170384056 20:15796652-15796674 TCAGCAGAGTGCCGGGCATTTGG + Intronic
1170403829 20:16015349-16015371 ACAGCACTGATCTGGGGAATTGG + Intronic
1171335219 20:24379439-24379461 ATAGCAGAGAGTTTGGCAAGAGG - Intergenic
1172587943 20:36097908-36097930 ACGGCAGGGAGCTGGGGAAGAGG + Intronic
1172618062 20:36302603-36302625 CCAGCAGAGAGCTGGGGGATGGG - Intergenic
1173454357 20:43190822-43190844 ACAGCAGAGAGCCAGGCTGTGGG - Intergenic
1173577339 20:44121374-44121396 ACAGCAGAGAACTGGGCGCACGG + Intronic
1174210024 20:48870601-48870623 ACATCTGAGAGCAGGGCACTTGG - Intergenic
1174595249 20:51678624-51678646 ACAGCAGATGGCTGGACAGTGGG + Intronic
1176086195 20:63296622-63296644 CCAGCAGGGAGCTGGGGAAGGGG + Intronic
1177479155 21:21663649-21663671 ACAACAAAGAGATGGGAAATAGG + Intergenic
1179059299 21:37965044-37965066 TCAGCATGGACCTGGGCAATAGG + Intronic
1179946650 21:44682709-44682731 CCAGCAGAGAGCTGGGAAATGGG - Intronic
1179958956 21:44757712-44757734 ACAGTAGAGAGCTGGGGGGTGGG + Intergenic
1180200382 21:46220566-46220588 GCAGCAGAGAGCAGGGCAGGTGG + Intronic
1180915695 22:19484887-19484909 AGAACAAAGAGCTGGGCAAGAGG - Intronic
1180942469 22:19668279-19668301 ACAGCCGAGAGCTGGGGCCTTGG - Intergenic
1181484117 22:23219752-23219774 AGAGGACAGAGCTGGGCAAGTGG - Intronic
1181809707 22:25395926-25395948 ACAGGAGGGAGCTGGGCAGCAGG + Intronic
1181909647 22:26228485-26228507 CCAGCATGGTGCTGGGCAATGGG + Intronic
1183477317 22:38042744-38042766 ACAGAAGAGGGCTGGGCCAGTGG + Intergenic
1184738698 22:46414432-46414454 ACAGGAGAGGGATGGGCCATCGG - Intronic
1184864509 22:47194829-47194851 CCAGCCCAGAGCTGGGCTATGGG + Intergenic
950399309 3:12758586-12758608 ATGCCAGAGAGCTGGGCCATGGG - Intronic
950685908 3:14618569-14618591 ACAGCATGGAGCTGGATAATAGG - Intergenic
952211939 3:31236592-31236614 ACAGCGGAGAGCTGGGTCAAAGG - Intergenic
955064681 3:55524192-55524214 ACAGCAGAGAGCTGGGCAATAGG + Intronic
955823941 3:62925029-62925051 ACACAAGAGAGCTTGGCAGTGGG - Intergenic
956158584 3:66324236-66324258 ACAGCAGGGGGCTAGGGAATGGG + Intronic
956366046 3:68504234-68504256 AACTCAGAGAGCTGGGCAAGAGG - Intronic
956704398 3:71986920-71986942 AAAGCAGAGAGCTGTGTAGTTGG + Intergenic
957698742 3:83681034-83681056 ACAGGTGAGAGCTGAACAATGGG + Intergenic
959351814 3:105274845-105274867 ATAGCAGAGGACTGGGAAATGGG - Intergenic
959902204 3:111673876-111673898 ACTGCAGAAAGCAGGGAAATGGG + Intergenic
960037647 3:113117946-113117968 ACAGATGAGAGTTTGGCAATTGG + Intergenic
960385410 3:117016666-117016688 AGAGGAGAGAGCTGGCCAAGTGG + Intronic
961464788 3:127074721-127074743 TCTGCAGAGAGCTGGGCTAGTGG + Intergenic
961739737 3:129025685-129025707 CCAGCAGAGAGAGGGGCAATGGG + Intronic
962267989 3:133957073-133957095 AGAGCAGAAAGAAGGGCAATGGG - Intronic
963840378 3:150098721-150098743 ATAGCAGAGAGCTGTCCAATAGG + Intergenic
967605068 3:191435133-191435155 TCATCAGAAAGCTGGGAAATGGG - Intergenic
968049367 3:195643493-195643515 ACAGCAGAGGGCAGGGCAGAGGG + Intergenic
968098036 3:195946131-195946153 ACAGCAGAGGGCAGGGCAGAGGG - Intergenic
968305251 3:197646439-197646461 ACAGCAGAGGGCAGGGCAGAGGG - Intergenic
968644231 4:1730948-1730970 ACAGCAGAGAGCAAGGTAAGGGG + Exonic
969197997 4:5578492-5578514 AAATCACAGAGCTGGGCAAGAGG + Intronic
972453993 4:39233981-39234003 ACATGACAGAGCTGGGCAGTAGG - Intronic
973603881 4:52567922-52567944 ACAGCTGAGAGCTTGGGAAGAGG + Intergenic
977031598 4:91891195-91891217 ACAGCAGAAGGCTCTGCAATAGG + Intergenic
979062223 4:116078252-116078274 AAAGCAGAGAGTGGGGCACTAGG + Intergenic
980469848 4:133236953-133236975 ACACCAGCGAGCTGGAGAATAGG - Intergenic
981648448 4:147027238-147027260 AAAGCAGAGAGCAGGGGAATTGG + Intergenic
982321102 4:154078269-154078291 ACAGCTGAGTGCTGGCCATTAGG + Intergenic
986006920 5:3676428-3676450 ACAGCAGAGAACTGAGCAGCAGG + Intergenic
986896309 5:12373929-12373951 ACAGCACTGAGCTGGGTACTGGG + Intergenic
988585657 5:32505360-32505382 ACAGCAGAGGGCGGGGGAGTGGG + Intergenic
988674182 5:33414427-33414449 AAAGCACAGAGCTGGGAAGTGGG + Intergenic
988684946 5:33517004-33517026 TGAGCAGGGAGCTGGGGAATGGG - Intergenic
989000710 5:36757388-36757410 ATAGCCTAGAGATGGGCAATAGG - Intergenic
989131646 5:38112912-38112934 ACAGGATAGAGCTGGGCATTTGG + Intergenic
990255596 5:53965542-53965564 ACAGAAGAGAGTTGGGCTTTTGG + Intronic
990630889 5:57667862-57667884 ACACCTCAGACCTGGGCAATTGG + Intergenic
994671480 5:102766546-102766568 ACAGCAAAGAGGTGAGCAGTGGG - Intronic
995029537 5:107464618-107464640 ACAGCAGAGAGCTGAGTTATTGG - Intronic
995551919 5:113290049-113290071 ACAGCTGCGAGCTGGCCACTTGG + Intronic
997422390 5:133779756-133779778 CCAGCAGAGAGCTGGGGAGGTGG - Intergenic
997714833 5:136034672-136034694 CCACCAGGGAGCTGGGCAGTGGG - Intronic
1000089255 5:157915951-157915973 TCAGCTGAGAGCTGGGCAGGCGG - Intergenic
1002061878 5:176630197-176630219 ACAGGAGGGAGCTGGGGAAGGGG - Intronic
1002820489 6:720050-720072 ACTGCAGTGAGCTGGCCACTTGG + Intergenic
1003021485 6:2513793-2513815 ACACAAGACAGCTTGGCAATGGG + Intergenic
1003564360 6:7210364-7210386 ACAACAGATAGATGGGCAGTGGG + Intronic
1003712296 6:8605457-8605479 CCAGCAGAGAGAAAGGCAATGGG - Intergenic
1004466201 6:15887564-15887586 TCAGCAGAGAGCTGGTGATTGGG + Intergenic
1008652207 6:53575088-53575110 AGAGAAGAGAGCAGGGCACTAGG + Intronic
1010260566 6:73811139-73811161 ACAGCAGAGGTGTGGGCAAGGGG + Exonic
1010409806 6:75548104-75548126 ACTGCAGAGAGCTGGTTACTGGG - Intergenic
1011701034 6:89955062-89955084 AGAGCACAGTGCTGGGCACTAGG - Intronic
1011799188 6:90991759-90991781 ACATCAGAGACCTGGCCATTGGG - Intergenic
1012765198 6:103358160-103358182 GCAGCAATGAGCTGGGCAAGTGG - Intergenic
1012962990 6:105642567-105642589 GCAGCAGAAAGCTTGGCAACAGG + Intergenic
1013078501 6:106791914-106791936 GCAACATAGAGCTGGGGAATGGG - Intergenic
1015589267 6:134806923-134806945 ACAGCAGACATCTGAGCAAAAGG + Intergenic
1016428097 6:143955658-143955680 CCACCAGGGAGCTGGGCAATGGG + Intronic
1016635133 6:146280171-146280193 ACACCAGAGAGCTGGGGTCTTGG - Intronic
1017028767 6:150202726-150202748 ACAGCCGAGGGCTGGGCAAAAGG - Intronic
1017518603 6:155181123-155181145 ACAGCAGAGACCTAGGGAACAGG + Intronic
1017848041 6:158276672-158276694 AAAACAGAGTGCTGGGCAAAGGG - Intronic
1019738623 7:2662242-2662264 ACTGCAGAGAGATGGGCACGTGG - Exonic
1020032996 7:4945915-4945937 AAAGCAGAGAGCTCTGAAATTGG + Intronic
1021797171 7:24267734-24267756 ACAGCAGAGGTCTGTGAAATAGG - Intergenic
1021807155 7:24368799-24368821 ACCACAGGGAGCTGGGCAGTGGG + Intergenic
1022288302 7:28976346-28976368 ACAGCAGAGCTCTTGGCACTTGG + Intergenic
1023118975 7:36890392-36890414 TCAGCAGAGAGATGGACAGTGGG - Intronic
1023191100 7:37584076-37584098 ACAGCAGAGACCCAGGAAATAGG + Intergenic
1023256022 7:38313193-38313215 TCAGCAGGCAGCTGGGAAATAGG + Intergenic
1026208626 7:68280997-68281019 ACAGCAGTGAGCCAGGCAGTTGG - Intergenic
1027226438 7:76246879-76246901 ACCTCATAGAGCTGGGAAATGGG - Intronic
1029526786 7:101099607-101099629 AAGGCAGAGAACTGGGCATTGGG - Intergenic
1029551002 7:101237097-101237119 ACAGCACAGGGCTGGGAAAGGGG + Intronic
1034311806 7:150095051-150095073 ACAGCAGGGAGCTGGCCCAGAGG - Intergenic
1034795048 7:154005603-154005625 ACAGCAGGGAGCTGGCCCAGAGG + Intronic
1036642415 8:10592691-10592713 ACAGCAGAGGGCTGGACACGTGG - Intergenic
1037623479 8:20587647-20587669 ACAGCAGAGAGCTGCACACCAGG - Intergenic
1037680920 8:21096831-21096853 AAAGCAGAGAGCTTAGGAATGGG + Intergenic
1037761990 8:21747632-21747654 ACCGCAGAGAGATGGGAGATGGG - Intronic
1037802000 8:22040964-22040986 AAAGCAGAGAGGTGGGCACGCGG + Intergenic
1037992103 8:23328422-23328444 TCTGCAGAGAGCTGGGCTTTGGG - Exonic
1038155160 8:24982373-24982395 ACAGCAGACAGCTAAGCACTTGG - Intergenic
1038779802 8:30560357-30560379 ACAGTAGAGAGATGAGTAATGGG + Intronic
1039180817 8:34864137-34864159 TCAAGAGAGAGTTGGGCAATGGG + Intergenic
1039324204 8:36466738-36466760 ACAGGAGAAGGCTGTGCAATAGG - Intergenic
1040487647 8:47889002-47889024 ACAGCACAGAGGTGGGTACTTGG - Exonic
1040588490 8:48766630-48766652 ACAGCAGTGAGCTGTGCAGGTGG + Intergenic
1041888191 8:62837613-62837635 TCAGCAGACAGATGGGAAATGGG - Intronic
1042606016 8:70547564-70547586 AAAACTGAGAACTGGGCAATAGG - Intergenic
1043095492 8:75965085-75965107 ACAGCTGAGAGAAGGGCAAAGGG + Intergenic
1044230940 8:89776959-89776981 AAGGCAGGAAGCTGGGCAATCGG - Intronic
1044826156 8:96199275-96199297 AAGGCAAAGAGGTGGGCAATAGG - Intergenic
1044926988 8:97217944-97217966 ACAGCAAAGAGCTGGGTAATGGG + Intergenic
1045306289 8:100959322-100959344 ACTGCAGACAACTGGACAATTGG - Intergenic
1046319886 8:112558648-112558670 ACACCAGAGAGCTGGATAATTGG + Intronic
1047310495 8:123687854-123687876 ATAGCAGAGAGATGGGCATGGGG - Intronic
1047364521 8:124200078-124200100 ACTGCAGAGAGCTGAGCACCTGG + Intergenic
1047724266 8:127670557-127670579 AGAGGAGAGAGCAGAGCAATGGG - Intergenic
1049230893 8:141480591-141480613 AAAGAAGAGAGCTGGGCGCTGGG - Intergenic
1049246213 8:141563969-141563991 ACAGCACAGAGCTTGGGGATAGG - Intergenic
1049526281 8:143128301-143128323 ACCCCAGAGAACTGGACAATTGG + Intergenic
1050074361 9:1848093-1848115 ACAGAAGAGTGCTGGGGGATAGG - Intergenic
1050957521 9:11683608-11683630 ATACCAGAGAGCTGTGCTATGGG - Intergenic
1055055986 9:72024512-72024534 AAAGCAGGGAGCTGGGGAAGAGG + Intergenic
1055783678 9:79848036-79848058 ACAGAAGAGAGATGGGAATTTGG + Intergenic
1056791901 9:89631438-89631460 CCTGCAGGAAGCTGGGCAATTGG - Intergenic
1057722948 9:97547321-97547343 ACAGCATGGAGCTGGGCAGCAGG - Intronic
1059674599 9:116525920-116525942 AAAGCAGAGAGGTGTGAAATTGG - Intronic
1062501211 9:136852809-136852831 CCAGCAGGGAACTGGGCACTGGG - Intronic
1187737820 X:22322477-22322499 ACAGAAGAGGGCTGGGAAAAGGG - Intergenic
1188481016 X:30636998-30637020 ATAGGAGAGAACTGGGCAAAAGG - Intergenic
1189225391 X:39409114-39409136 AGTGCAGAGAGCTGGGGAAAGGG - Intergenic
1192230654 X:69262684-69262706 GGAGCAGAGAGCTGGCCAAGCGG - Intergenic
1193826439 X:86232130-86232152 CCAGTAGAGAGCAGGCCAATTGG + Intronic
1195292304 X:103441109-103441131 AAAGCAGTGAGCTAGGAAATCGG + Intergenic
1196050348 X:111297738-111297760 ACAGCAGAAACCAGGGCAAAAGG - Exonic
1198222754 X:134617757-134617779 ATAGCACAGAGCTGGGCACATGG - Intronic
1198251041 X:134879495-134879517 ACAAAAGAGTGCTGGGGAATTGG - Intergenic
1199435764 X:147810940-147810962 CCAGCAGACAGTTGGGCAAATGG - Intergenic
1199700860 X:150374696-150374718 ACTGCCGAGGGCTGGGTAATTGG - Intronic
1199867904 X:151870778-151870800 ACAGCAGAGAGATTGCCAATGGG - Intergenic