ID: 955066138

View in Genome Browser
Species Human (GRCh38)
Location 3:55535155-55535177
Sequence GCCCCACTTGGAAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955066138 Original CRISPR GCCCCACTTGGAAAGCTGGT TGG (reversed) Intronic