ID: 955066138

View in Genome Browser
Species Human (GRCh38)
Location 3:55535155-55535177
Sequence GCCCCACTTGGAAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955066138 Original CRISPR GCCCCACTTGGAAAGCTGGT TGG (reversed) Intronic
900479726 1:2892108-2892130 GCCCCACTGGGCTGGCTGGTGGG - Intergenic
900688833 1:3966980-3967002 GTCCCACTTGGAATGTGGGTGGG + Intergenic
900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG + Intergenic
901059285 1:6464705-6464727 GCGCCACCTGGGAGGCTGGTGGG + Exonic
903615752 1:24654953-24654975 GCCCCCCTCGGAAAACTCGTAGG + Exonic
905370668 1:37481118-37481140 GCCCCACCTGGGGAGCTGCTGGG - Intronic
905678910 1:39852335-39852357 CTCCCACTGGGAAAGCTGCTGGG + Intronic
907185820 1:52608309-52608331 GCCCCAGATGGAAAGGTGGTAGG + Exonic
907632122 1:56093094-56093116 GCCCCATTTGGGAAGCTGCATGG - Intergenic
909492907 1:76245540-76245562 GCCCACATTGGAAAGCTGGAAGG - Intronic
912222001 1:107689132-107689154 ACGGCACTTGGAAAACTGGTGGG + Intronic
919788318 1:201274439-201274461 GGCCCATTTGGAAAGCAGGAGGG + Intergenic
920336557 1:205249058-205249080 GCCCCACTTTGAGAGCAGGCAGG + Intronic
923126170 1:231036487-231036509 GGCCCACTTGGAAAGCTTCAAGG - Intronic
923491446 1:234487607-234487629 GCCCGACTTGTAATGATGGTTGG - Intergenic
1063147454 10:3308982-3309004 GCCCCACTTGGACGGCAGCTGGG - Intergenic
1068934038 10:62618855-62618877 GCCACACTGGGAAAGCTGAGTGG - Intronic
1069768175 10:70879227-70879249 CCCCCACTGGGAATGCTGGCTGG + Exonic
1070705771 10:78636897-78636919 GCCTCCTTTGGAATGCTGGTTGG + Intergenic
1072741297 10:97911558-97911580 GCCCCCATTGTAAAGCTGCTGGG - Intronic
1074709733 10:116167297-116167319 GCCCCACCTGCAATGCTGGGTGG - Intronic
1076618769 10:131773621-131773643 GCTCCACGTGGAAACCTGGAAGG + Intergenic
1081472306 11:43386826-43386848 GCCCCAGCTGGAAAGCAGGTAGG + Intronic
1084702633 11:70797289-70797311 GCTCCACTCGGAAGGCTGGGTGG - Intronic
1084908017 11:72363705-72363727 GCTCAACTTGCAATGCTGGTCGG + Intronic
1090000333 11:122950861-122950883 TCCCCAGTTGGAAAGATGGCTGG - Intronic
1090327912 11:125904666-125904688 GCCCCACTTCGAACGCTCGCGGG - Intronic
1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG + Intronic
1100578085 12:95911784-95911806 GCCCCATGTGGAAAGCAGTTTGG + Intronic
1101527901 12:105548343-105548365 GGCCCACTTGGAAAGCCACTTGG + Intergenic
1101607046 12:106255099-106255121 GCCCCATGTGGATACCTGGTGGG - Intronic
1106657291 13:31759768-31759790 GCCCCACTTTGATGGATGGTTGG - Intronic
1107153792 13:37142709-37142731 GCCCAACTGGGGAAGCTGATAGG + Intergenic
1112496901 13:99912414-99912436 CCTCCACTTGAAAATCTGGTGGG + Intergenic
1115627893 14:35213317-35213339 TCCTAGCTTGGAAAGCTGGTGGG + Intronic
1117539328 14:56731364-56731386 GCCTCACTTTGCAAGCTGCTTGG + Intergenic
1120840804 14:89083285-89083307 CCCCCACTTGGAAAGCAGCCAGG - Intergenic
1123398182 15:19957515-19957537 GCTCAACTTGGAGAGCTGGAAGG - Intergenic
1124810883 15:32936971-32936993 GCCCGACTTGGAGTGCTGATGGG - Intronic
1128673953 15:69595281-69595303 GCCCCAGCTGGAAAGCAGGAGGG - Intergenic
1129158009 15:73730946-73730968 GCCCCACTTGGCAAGGGGGTAGG - Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1129681275 15:77659813-77659835 GCCTGACCTTGAAAGCTGGTGGG + Intronic
1130223134 15:82038338-82038360 TCCCTTCCTGGAAAGCTGGTTGG + Intergenic
1130435004 15:83889288-83889310 TCCCCATTTGGAAAGCTTATTGG + Intronic
1130986538 15:88848148-88848170 TTCCCACCTGGAAAGCTGGGTGG - Intronic
1133481598 16:6176011-6176033 GCCTCCCCTGGAAAGCTTGTGGG - Intronic
1133628262 16:7592546-7592568 GCCCCACTGGTATAGCTGGAGGG - Intronic
1137606095 16:49787791-49787813 GCCCCACCGGGAAAGCAGCTGGG + Intronic
1138193472 16:55035273-55035295 GCACCCCTGGGAAAGCTGGCTGG + Intergenic
1138521756 16:57575213-57575235 GCTCCACTAGCTAAGCTGGTGGG + Intronic
1138594262 16:58021347-58021369 GCCTCTCTGGGAAAGCTGCTGGG - Exonic
1139371398 16:66471550-66471572 GCTCCCCTGGGAAAGCTGTTAGG + Intronic
1142753278 17:2000896-2000918 GCCCCTCTTGGAGGGATGGTGGG + Intronic
1144373855 17:14619527-14619549 GCCCCACTGGGACAGTTGGTTGG + Intergenic
1153675199 18:7450893-7450915 GCCACACTTGGTTAGCAGGTTGG - Intergenic
1155410287 18:25536704-25536726 GCCACACTTGGAAATATTGTGGG + Intergenic
1156257218 18:35409823-35409845 GCTCCACTGAGAAAGCTGGCTGG + Intergenic
1156447481 18:37248417-37248439 GCGCCACATGGAAGGCTGGAGGG + Intronic
1158258801 18:55586237-55586259 GCCCCACTTGGAAGGCGGTTTGG + Intronic
1159615967 18:70580137-70580159 GAGCCACATGGAAAGCTGGTTGG - Intergenic
1160021608 18:75185837-75185859 GCCCCACTGGTAAAGCTGCCAGG + Intergenic
1162000948 19:7744822-7744844 GCTCCACTTGGAAAGAAGGGAGG - Intronic
1162887536 19:13707112-13707134 TCCCCATTTGGAAGGCTGGATGG + Intergenic
1165178464 19:33947453-33947475 GCACCACTTGGACAGTGGGTGGG + Intergenic
1168445908 19:56413242-56413264 GCATCACTTTGACAGCTGGTTGG + Intronic
925775718 2:7333420-7333442 GCCCCATTCAGAAAGCTGCTAGG - Intergenic
928025389 2:27735417-27735439 GCCCCACCTGGACACCTGGAGGG + Intergenic
928288144 2:30011216-30011238 GACCTACATGGGAAGCTGGTGGG + Intergenic
929903977 2:46030068-46030090 GCCTCACTTGCAAAACTGCTGGG + Intronic
934067102 2:88350572-88350594 GCCCCACTTGGAGGTCTGGGTGG + Intergenic
934655324 2:96114332-96114354 GCCCCACTGGGAAAAGTGGAAGG + Exonic
936091733 2:109505928-109505950 CCTCCACTTGGCAAGCTGGCTGG - Intergenic
941952204 2:171167136-171167158 GCACCACTTGTTAAGCTGGGTGG + Intronic
942986465 2:182148605-182148627 CCCACATTTGGAAAGCTGATGGG - Intronic
944981865 2:205129986-205130008 GCCCCAGATGGAAAGAAGGTTGG - Intronic
947593539 2:231397647-231397669 GCCCCCCTTGGGAGGCTGGGTGG - Intronic
947668984 2:231925085-231925107 GCCCCTATTGGCCAGCTGGTGGG - Intronic
948750340 2:240128566-240128588 GCCACATTTAGAAAGCTGCTGGG - Intronic
1174182422 20:48683195-48683217 CCCCCAATTAGACAGCTGGTGGG - Intronic
1176744866 21:10642247-10642269 GCTCAACTTGGAGAGCTGGAAGG - Intergenic
1177167888 21:17623627-17623649 TCTCCACTTGGATAGCTGATAGG + Intergenic
1184512011 22:44939484-44939506 CCCCCACCTGGGAAGCTCGTGGG - Intronic
951531499 3:23702434-23702456 GCCCCACTTCTAAAGATGCTAGG - Intergenic
951615677 3:24540880-24540902 GCCCCAGATGCAAAGCTGGCTGG - Intergenic
953336097 3:42095193-42095215 GCCACACTTGGAAACCTGCCAGG - Intronic
954408039 3:50356270-50356292 GCCCCACTTTGAGGGCAGGTGGG + Intronic
955066138 3:55535155-55535177 GCCCCACTTGGAAAGCTGGTTGG - Intronic
962314300 3:134349612-134349634 GCCCCACTCAGGATGCTGGTGGG + Intergenic
967903410 3:194481002-194481024 GCACCAGTTTGAAAACTGGTTGG - Intronic
968902278 4:3437342-3437364 GCCCCACATGGACAGATGGGAGG - Intronic
972775365 4:42234965-42234987 GCCCCAGTTGAGTAGCTGGTGGG - Intergenic
977270993 4:94917227-94917249 GCCCCACTGGGAATGCTGTGTGG - Intronic
981936200 4:150242568-150242590 ACCCCACTTGCACACCTGGTAGG + Intronic
983006778 4:162493554-162493576 GCCCCAGTTGGGAATCTGTTTGG - Intergenic
985171043 4:187150480-187150502 GCCCCACTTCCAACGCTGGGGGG + Intergenic
995527001 5:113058320-113058342 ACCCCTCTTGGAAAACTGCTGGG - Intronic
997834017 5:137177852-137177874 TCCCTACTTGGAAAGCTTTTTGG - Intronic
998957337 5:147452070-147452092 GCACCAGCTGGGAAGCTGGTAGG + Intronic
1000467574 5:161598913-161598935 GCCCCATCAGGAAAGCTGTTTGG + Intronic
1000981879 5:167825050-167825072 TCCCCACTTGGAAATCTGGTTGG + Intronic
1008090383 6:47287967-47287989 CACACACTTTGAAAGCTGGTTGG + Intronic
1009656294 6:66549470-66549492 GCCCACCTTGGAAAGCTTTTGGG + Intergenic
1010584589 6:77642461-77642483 GCCCATATTGGAATGCTGGTTGG - Intergenic
1011671489 6:89687816-89687838 GGCCCACCTGGAAGGCTGGGAGG + Intronic
1020107215 7:5427730-5427752 TCCCCACCTGGAAAGGCGGTTGG - Intergenic
1021798261 7:24279243-24279265 GCCCAAATAGGAAAGCTGATTGG + Intergenic
1024170663 7:46781950-46781972 GCCACACTTGAGAAGGTGGTGGG - Intergenic
1024462262 7:49670682-49670704 GACCCAGTTGGCGAGCTGGTAGG - Intergenic
1027135617 7:75621925-75621947 GCTCCACTGGGATACCTGGTGGG - Intronic
1030114873 7:106055468-106055490 GACCCACCTGGAAAACTGATGGG - Intergenic
1031357823 7:120809758-120809780 TCCCCACTTGAGAAGATGGTTGG + Intronic
1033065719 7:138152041-138152063 TCTCCATTTGGAAAGCTAGTTGG - Intergenic
1033650552 7:143339513-143339535 GCTGCATTTGGAAGGCTGGTAGG + Exonic
1034858669 7:154577559-154577581 GATCCCCTTGGCAAGCTGGTGGG - Intronic
1040497908 8:47982934-47982956 GCCCCAGTTGGAAAGTTTGTGGG + Intergenic
1046852772 8:118994141-118994163 GCCACACTTAGAAAGCAGATGGG - Intergenic
1056941693 9:90961639-90961661 GCCCCACGTAGACAGCTGGCTGG + Intergenic
1061206532 9:129167122-129167144 GCACAACTAGGAAAACTGGTTGG + Intergenic
1062408521 9:136409827-136409849 GCCCCACGAGGAAAGCGGGCGGG + Intronic
1185522449 X:751686-751708 GATCCCCTTGGAGAGCTGGTTGG + Intergenic
1186076684 X:5887268-5887290 GCACCACTTTGAGAGCTCGTTGG + Intronic
1186241123 X:7567520-7567542 GCCCCAGTTTGAAAGCTGACAGG - Intergenic
1196032350 X:111104051-111104073 GCCCAACTTGCAAAGCTGCTGGG - Intronic
1196263004 X:113607788-113607810 ACCCCACTAGGAAGGCTGGTGGG + Intergenic
1201460878 Y:14222605-14222627 GCCCCAGTTTGAAAGCTGAAAGG - Intergenic