ID: 955067895

View in Genome Browser
Species Human (GRCh38)
Location 3:55548142-55548164
Sequence TGCCAGGCTGAAGTGACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 472}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955067892_955067895 20 Left 955067892 3:55548099-55548121 CCTCCAAATAAAAATCACAAGGA 0: 1
1: 0
2: 4
3: 40
4: 501
Right 955067895 3:55548142-55548164 TGCCAGGCTGAAGTGACCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 472
955067893_955067895 17 Left 955067893 3:55548102-55548124 CCAAATAAAAATCACAAGGATTT 0: 1
1: 0
2: 4
3: 62
4: 598
Right 955067895 3:55548142-55548164 TGCCAGGCTGAAGTGACCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955067895 Original CRISPR TGCCAGGCTGAAGTGACCTG TGG Intronic
900295242 1:1945758-1945780 TTAGAGGCTGAAGTGAGCTGTGG + Intronic
900746212 1:4362357-4362379 TGCCAGGTTAAAGTCACGTGTGG - Intergenic
901199065 1:7456590-7456612 TGCCAGGCTGCTGGGATCTGCGG - Intronic
902316570 1:15624533-15624555 GTCCAGGCTGTAGTGAGCTGCGG - Intronic
903127755 1:21259307-21259329 TCCCAGGCTGAAGTGCAGTGGGG + Intronic
903555356 1:24188916-24188938 TGGGAGGCTGAGGTCACCTGAGG - Intergenic
904285536 1:29451240-29451262 TGCCAAGGTGAATTGCCCTGAGG + Intergenic
904880937 1:33696475-33696497 TGCCAGGCTGAATGGACCCATGG + Intronic
905011221 1:34748181-34748203 TGCCAGTGTGAAGGGACCTCAGG - Intronic
905327038 1:37160694-37160716 AGCCAGGCAGGAGAGACCTGTGG + Intergenic
905546251 1:38802460-38802482 TGGCAGGCTGCACTGACCTCAGG - Intergenic
905881736 1:41468444-41468466 TGCCAGGCTAGAGTGGGCTGTGG + Intergenic
908260181 1:62334259-62334281 TGCCAGGGTGCAGTGGGCTGGGG + Intergenic
908362208 1:63380273-63380295 TGCCAGACTGTAATGAACTGAGG + Intronic
908641178 1:66225266-66225288 AGCCTGGCTGAAGTGAGTTGAGG - Intronic
910967581 1:92823100-92823122 GTTCAGGCTGCAGTGACCTGTGG + Intergenic
911333373 1:96551661-96551683 GTCCAGGCTGCAGTGAGCTGAGG - Intergenic
911790162 1:102004800-102004822 GTCCAGGCTGCAGTGAGCTGTGG + Intergenic
914751390 1:150537464-150537486 ATCCAGGCTGCAGTGAGCTGAGG + Intergenic
915074825 1:153299404-153299426 GGCCAGGTTGAAGTGGACTGTGG - Intronic
915440560 1:155942916-155942938 TGCCAGGCTGCAGTGCCCTCAGG + Exonic
916820675 1:168395211-168395233 TTCAAGGCTAAAGTGATCTGTGG - Intergenic
916920675 1:169462719-169462741 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
917309855 1:173667662-173667684 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
919661654 1:200253627-200253649 TGCCAGGCTGAAGAGACCCCAGG - Intergenic
920188978 1:204180243-204180265 TTCGAGGCTGCAGTGAGCTGTGG + Intergenic
920902603 1:210126159-210126181 CGCCAGGCTGGAGTGCACTGGGG - Intronic
921262236 1:213394607-213394629 TCCCAGGCTGCAAAGACCTGGGG - Intergenic
921277436 1:213533751-213533773 TGCCAGTCTGAAATTACATGTGG + Intergenic
921291748 1:213664058-213664080 GGTCAGGCTGCTGTGACCTGCGG - Intergenic
921711615 1:218378672-218378694 TTCCAGGCTGCAGTGAGCTATGG - Intronic
921746960 1:218750778-218750800 TTCTAGGCTGAAGTTCCCTGAGG + Intergenic
922201198 1:223402978-223403000 TACCAGGCAGAAGGGATCTGGGG - Intergenic
922814757 1:228440593-228440615 TTCCAGGCTGCAGTGAGCTAGGG - Intergenic
923235625 1:232030432-232030454 GGCCAGGCAGAACTGCCCTGAGG - Intronic
923659760 1:235947905-235947927 TTCGAGGCTGCAGTGACCTATGG - Intergenic
924114512 1:240732007-240732029 TGCCAGGCTGGAGTGCAGTGTGG + Intergenic
924715034 1:246565668-246565690 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1063101753 10:2956209-2956231 TGCAAGGCTGGAGAGACCTCAGG + Intergenic
1063134818 10:3207505-3207527 GGCCAGGATGAACTGACCGGGGG - Intergenic
1063478260 10:6347591-6347613 TGCAAGGCAGCAGTGATCTGTGG + Intergenic
1063679107 10:8170315-8170337 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1064135214 10:12744831-12744853 TTCAAGGCTGCAGTGAGCTGTGG + Intronic
1064397241 10:14991812-14991834 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1064551007 10:16500806-16500828 TTCAAGGCTGCAGTGACCTATGG - Intronic
1064744109 10:18462320-18462342 TTCAAGGCTGCAGTGAGCTGCGG - Intronic
1065359143 10:24872847-24872869 GGCCAGGCTGAAGTGCAGTGGGG + Intronic
1065483191 10:26214629-26214651 TGCGAGGCTGGAGAGAGCTGCGG + Intergenic
1065833355 10:29634930-29634952 CCCCAGGCTGAAGTGTCCTCAGG - Exonic
1066096480 10:32077092-32077114 TCCCAGGCTGAAGTGCAATGGGG - Intergenic
1066118056 10:32257531-32257553 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1069513530 10:69059496-69059518 TTCCAGGCTGCAGTGAGCTATGG - Intergenic
1069847904 10:71385321-71385343 TGCCAGGCAGATGTGACATCAGG - Intergenic
1071549900 10:86558845-86558867 TTCCAGGCTGCAGTGAGCTATGG - Intergenic
1073444381 10:103571870-103571892 TGCCAGGCTGCAGTGCCCAGAGG - Intronic
1075279210 10:121125310-121125332 TGCCAGGCTGGAGTGCAGTGAGG + Intergenic
1076810962 10:132886102-132886124 CGCAGGGCTGAAGTGAGCTGTGG + Intronic
1077489636 11:2854912-2854934 TGCCTGGCAGAAGTGTCCCGTGG - Intergenic
1078193162 11:9110289-9110311 TCCAGGGCTGAAGTGAGCTGTGG + Intronic
1078938213 11:15971421-15971443 TGCCAGGCAGGAGAGTCCTGCGG - Exonic
1079602569 11:22327985-22328007 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1079754010 11:24233468-24233490 TACAAGGCAGAAGTGATCTGGGG - Intergenic
1081424082 11:42905600-42905622 GCCCAGGCTGGAGTGCCCTGGGG - Intergenic
1081478144 11:43457025-43457047 TGGGAGACTGAAGTGAGCTGGGG + Intronic
1082028040 11:47586962-47586984 TACCAGGCTGATGTGTGCTGTGG + Intronic
1082944368 11:58741976-58741998 TGCCAGGCTGACTTGAGCAGTGG - Intergenic
1083708070 11:64530253-64530275 GGCCAGTCTGCAGTGCCCTGGGG + Intergenic
1083825352 11:65200115-65200137 GTCGAGGCTGAAGTGAGCTGAGG - Intronic
1083986437 11:66218816-66218838 TGCCAGGCTGGAGTGCAGTGAGG - Intronic
1083987073 11:66222474-66222496 TGTGAGCCTGAAGTGACCTCAGG + Intronic
1084056382 11:66636447-66636469 TTCCAGGCTGCAGTGAGCTATGG + Intronic
1084261137 11:67979478-67979500 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1084485511 11:69445528-69445550 GGCCGGTCTGAAGTGACCTCGGG - Intergenic
1084807500 11:71589076-71589098 TTCTGGGCTGAAGTGCCCTGGGG - Intronic
1084811512 11:71614617-71614639 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1084844594 11:71889081-71889103 TTCTAGGCTGAAGTGGCCTGGGG - Intronic
1085518151 11:77123137-77123159 TCTCAGGCTGATGTGGCCTGGGG + Intronic
1085522398 11:77146293-77146315 TGCCAGGCTGAGGAGCCCAGGGG + Intronic
1085591814 11:77770020-77770042 TTCAAGGATGAAGTGGCCTGTGG - Intronic
1087294257 11:96351310-96351332 TGCCAGGCTGTAGTGCAGTGGGG - Intergenic
1088315113 11:108498846-108498868 TTCCAGGCTGCAGTGAGCTGTGG - Intergenic
1089973307 11:122711596-122711618 GGCCAGGCTGAAGTGCCCGGGGG - Intronic
1090401902 11:126454361-126454383 TGCCAGGCTCTGGTCACCTGGGG - Intronic
1090712200 11:129397214-129397236 TTCCAGACTGCAGTGAGCTGTGG + Intronic
1091738405 12:2942159-2942181 TGCCAGGCTGGAGTGGAGTGGGG + Intergenic
1092432396 12:8420034-8420056 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1092746004 12:11673152-11673174 TGCCAAGCTGCAGTGTTCTGAGG + Intronic
1093658616 12:21726634-21726656 TGCGAGGCTGTAATGAGCTGTGG - Intronic
1094055641 12:26266939-26266961 TGGAAGGATGGAGTGACCTGTGG - Intronic
1095971937 12:47908049-47908071 TGCCAGGCTCCAGGCACCTGGGG + Intronic
1096040969 12:48517119-48517141 GGCCAGGCTGACCTGACCTCAGG - Intronic
1096509028 12:52117000-52117022 TTCTGGGCTGAAGTGCCCTGGGG + Intergenic
1097165062 12:57080025-57080047 TTCGAGGCTGCAGTGAGCTGTGG - Intronic
1097708990 12:62897854-62897876 TGCCAAACTGAAGTGATGTGGGG + Intronic
1097714928 12:62955748-62955770 TCACAGGCTGAAGTGCTCTGGGG - Intergenic
1098748625 12:74268920-74268942 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
1100600523 12:96108542-96108564 TGTCAGCCTGCAGTGACCTTAGG - Intergenic
1102244298 12:111345402-111345424 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1102244397 12:111346064-111346086 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1102783011 12:115581829-115581851 TGCCAGGCTGAGATGAACTGTGG + Intergenic
1102818896 12:115891369-115891391 TGGCAGGCTGGATTGACCCGAGG + Intergenic
1102898405 12:116616999-116617021 TGCCAGGCTGGGGGGACCTGGGG + Intergenic
1103263045 12:119605493-119605515 GTCAAGGCTGCAGTGACCTGTGG - Intronic
1103266316 12:119633517-119633539 TTCAAGGCTGCAGTGAGCTGTGG + Intronic
1103601706 12:122058615-122058637 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1103663846 12:122545369-122545391 TGCCAGGCCGCAGTGAAGTGGGG - Intronic
1103926856 12:124427923-124427945 AGCCAGCCTGGGGTGACCTGAGG - Intronic
1104292888 12:127485440-127485462 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1104442849 12:128808940-128808962 AGCCAGGCTGCAGGGAGCTGGGG + Exonic
1104649971 12:130524389-130524411 AGCCAGGCTGCAGTGAGCAGGGG + Intronic
1104805900 12:131589029-131589051 TTCGAGGCTGCAGTGAGCTGTGG - Intergenic
1105524658 13:21165891-21165913 TCCCAGGCTGGAGTGCACTGGGG - Intronic
1105880444 13:24601133-24601155 TCCCAGGCTGGAGTGTACTGGGG - Intergenic
1106589725 13:31089009-31089031 TGCCATGCTGAAGCTGCCTGAGG - Intergenic
1107306104 13:39021384-39021406 TGCCAGATTGAAGAGAGCTGGGG - Intronic
1107544178 13:41421600-41421622 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1108057708 13:46500799-46500821 TGGGAGGCTGAGGTCACCTGAGG + Intergenic
1108357861 13:49643475-49643497 TGCCAGCCTGAGGTCTCCTGGGG - Intergenic
1108854462 13:54775661-54775683 AGAGAGGCTGAAGTGGCCTGAGG - Intergenic
1109450358 13:62506417-62506439 TGCCACGCTGAAATGATCTCAGG - Intergenic
1109492198 13:63116427-63116449 TACCAAGCTTAAGTTACCTGTGG + Intergenic
1109802984 13:67401785-67401807 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
1110576907 13:77067993-77068015 TTCAAGGCTGCAGTGAGCTGTGG - Intronic
1110594967 13:77310068-77310090 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1111613016 13:90628722-90628744 TGGCATGCTGAAGTGACCTCAGG - Intergenic
1112469724 13:99676528-99676550 TGGGAGGCTGAGGTGACTTGAGG - Intronic
1113459649 13:110472986-110473008 TGGCAGGCCGATGGGACCTGGGG - Exonic
1113598307 13:111549653-111549675 TGCCAGGCTACCGTGAGCTGGGG + Intergenic
1114615831 14:24067921-24067943 ATCCAGGCTGCAGTGCCCTGGGG - Intronic
1115149740 14:30270709-30270731 TGACAGGCTGAGGGGAGCTGGGG - Intergenic
1115434360 14:33356170-33356192 TGCCACACTGAAGAGACCAGTGG + Intronic
1117038776 14:51751539-51751561 TACTGGGCTGAAGTGGCCTGGGG - Intergenic
1117418943 14:55524464-55524486 TGCCAGGCTGGAGTGCAGTGGGG + Intergenic
1118793385 14:69116479-69116501 TGCCAGGCAGAAGGGCTCTGTGG + Exonic
1118817028 14:69321088-69321110 CGCCAGACTGAAGTGCCTTGGGG - Intronic
1118822000 14:69351842-69351864 TTCGAGGCTGCAGTGAGCTGTGG + Intronic
1120969731 14:90197430-90197452 TTCAAGGCTGCAGTGAACTGTGG - Intergenic
1121082816 14:91122230-91122252 GTCAAGGCTGAAGTGAGCTGTGG - Intronic
1122197878 14:100103058-100103080 TGCCAGGCTGGAGTGCAGTGAGG - Intronic
1122615955 14:103018158-103018180 TGCCACGCTGATCTGACCGGAGG + Intronic
1122678304 14:103435784-103435806 TTCCAGGCTGCAGTGAGCTCTGG - Intronic
1124033208 15:26029982-26030004 TGCCAGGCTGGAGTGCAATGGGG - Intergenic
1124372555 15:29111799-29111821 TGCCTGGCTGAGGTGCACTGGGG + Intronic
1125746599 15:42001277-42001299 TTCCAGGCTGAAGGGAGATGAGG + Intronic
1127582906 15:60353914-60353936 TGCATGGCTGCAGTCACCTGAGG - Intronic
1128105384 15:65040527-65040549 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
1129766334 15:78171359-78171381 GCCCAGACTGAAGAGACCTGGGG + Exonic
1131087513 15:89589189-89589211 GGGCAGACTGGAGTGACCTGGGG + Intronic
1131408255 15:92184294-92184316 TGGCAAGATCAAGTGACCTGCGG + Intergenic
1131433206 15:92402966-92402988 TGTCAGGCTCCACTGACCTGGGG - Intronic
1131713425 15:95080653-95080675 TGCCAGGCTGAAGTGCAGTGGGG + Intergenic
1131746445 15:95453662-95453684 TGGGAGGCTGAGGTCACCTGAGG - Intergenic
1133072111 16:3253579-3253601 TTCCAGGCTGCAGTGAGCTGAGG - Intronic
1133198425 16:4187194-4187216 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1133764558 16:8828704-8828726 TGCCAGGCTGGATTGAACAGCGG + Intronic
1134200656 16:12195895-12195917 GGAGAGGCTGAAGTGAACTGTGG + Intronic
1135623832 16:23978422-23978444 TGCTGAGCTGAAGTGTCCTGTGG + Intronic
1135744110 16:25001620-25001642 TTCAAGGCTGCAGTGAGCTGTGG - Intronic
1135855385 16:26005466-26005488 TACCAGGCTGAAGTGGCCCAGGG - Intronic
1136053020 16:27666648-27666670 TGGCAGGCCGAAGTCACTTGAGG - Intronic
1138091951 16:54182048-54182070 TGCCAGGCTGGAGTGCAGTGGGG + Intergenic
1138374416 16:56553009-56553031 TGGGAGGCTGAGATGACCTGAGG - Intergenic
1138412916 16:56853860-56853882 AGCCAGGCCGAAGGGACCTGGGG - Intergenic
1138422064 16:56905295-56905317 TGCCAGGCTGGAGTGAAATGGGG - Intronic
1138457845 16:57131616-57131638 GGCCAGGCTGGAGTGCCCGGCGG + Intronic
1140707779 16:77646937-77646959 CCCAAGGCTGCAGTGACCTGTGG - Intergenic
1141158701 16:81614401-81614423 TGTCATGCTGAAGTGACCCGTGG - Intronic
1141554697 16:84829297-84829319 TGCCAGGCTGCAGTGAGTAGGGG + Intronic
1143839158 17:9717836-9717858 TGCCAGGCTGAAGTGCAATGGGG + Intronic
1145069018 17:19787352-19787374 TTCCAGGCTGCAGTGAGCTATGG - Intronic
1145078502 17:19875040-19875062 TCCCAGGCTGAAGTGCAGTGGGG - Intergenic
1145762937 17:27437086-27437108 GTCCAGGCTGCAGTGAGCTGTGG + Intergenic
1145864862 17:28234640-28234662 TTCTGGGCTGAAGTGCCCTGGGG + Intergenic
1146173261 17:30648856-30648878 ACCCAGGCTGAAGTGCCGTGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146346721 17:32064888-32064910 ACCCAGGCTGAAGTGCCGTGTGG - Intergenic
1146388641 17:32400621-32400643 TGCTAGGCTGAAGGAACCAGAGG - Intergenic
1147994037 17:44351659-44351681 TGGCAGGCTGAGGTGAGCTGGGG - Exonic
1148021140 17:44554824-44554846 TCGGAGGCTGAAGTGAGCTGAGG - Intergenic
1148025558 17:44585163-44585185 TCCCAGGCTGAAGTGCAGTGGGG - Intergenic
1148994500 17:51697844-51697866 TTCCAGGATGAAGTATCCTGGGG - Intronic
1149076108 17:52597374-52597396 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1149487568 17:57055140-57055162 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1151402465 17:73864812-73864834 TGCCAGGCTGGAGGGATCAGTGG - Intergenic
1151489640 17:74425127-74425149 TGCCAGGCGGATGTGACTTTAGG + Intronic
1151610472 17:75170526-75170548 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
1151763989 17:76122675-76122697 TGCCTGGCAGCAGTGGCCTGGGG + Intergenic
1152054145 17:78009189-78009211 TGCCAGTCTGAAGTGACACTTGG - Intronic
1152605505 17:81287623-81287645 TGGCAGGCAGAAGTGGACTGCGG + Intronic
1153890183 18:9506593-9506615 ACCCAGGCTGAAGTGCACTGTGG + Intronic
1154081558 18:11262399-11262421 TGCCATGCTGAACATACCTGTGG - Intergenic
1154400450 18:14032005-14032027 TGCAAGACTGTAGTCACCTGAGG + Intergenic
1155046857 18:22110357-22110379 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
1155756600 18:29505764-29505786 TGCCAGGCTGGAGTGTGCAGTGG + Intergenic
1157541582 18:48514653-48514675 GTCCAGGCTGCAGTGAGCTGTGG + Intergenic
1158188904 18:54803322-54803344 TGCCAGGCAGAAGGGGCATGAGG + Intronic
1158292222 18:55955024-55955046 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
1160710130 19:547566-547588 AGGCAGGTTTAAGTGACCTGCGG + Intronic
1160773135 19:842627-842649 TGCCAGGCTGGAGTGCAGTGGGG + Intronic
1161149649 19:2701350-2701372 TCCCAGGCTGGAGACACCTGGGG - Intronic
1161487752 19:4544675-4544697 TGCCAGGCTGGAGTGCAGTGGGG + Intronic
1162014049 19:7834230-7834252 TCCCAGGTTCAAGTGAGCTGGGG - Intronic
1162420536 19:10563728-10563750 TTCAAGGCTGCAGTGAGCTGTGG - Intronic
1163473744 19:17512752-17512774 TGCCAGACTCAAGTGACTTGAGG - Intronic
1163891834 19:20023454-20023476 TGCCAGGCTGGAGTGTGCAGTGG - Intronic
1163943224 19:20513968-20513990 TTCTGGGCTGAAGTGCCCTGTGG + Intergenic
1163951551 19:20592470-20592492 TGCCAGGCTGGAGTGCAGTGGGG + Intronic
1164481033 19:28611124-28611146 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1165215687 19:34270542-34270564 TGGCAGCTTGAAGTGAGCTGAGG + Intronic
1165323260 19:35099250-35099272 TGCAAGTTTGAAGTGGCCTGTGG + Intergenic
1165933521 19:39375524-39375546 TGCCAAGAGGAAGGGACCTGGGG - Intronic
1165950974 19:39473754-39473776 TGCCTGGGTGGAGTGACCTTGGG + Intronic
1166209268 19:41295592-41295614 TGCAAGGCTGAAGGGAACAGAGG - Intronic
1166352790 19:42208050-42208072 AGCCAGGCTGATGTGACAGGTGG - Intronic
1166576358 19:43842430-43842452 TGCCATGTTGTAGTGACTTGGGG + Intronic
1166995142 19:46716502-46716524 TGGCAGGCGGAGGGGACCTGAGG + Exonic
1167028039 19:46936172-46936194 GTCCAGGCTGCAGTGAGCTGTGG + Intronic
1167406584 19:49313228-49313250 TTCAAGGCTGCAGTGAACTGTGG - Intronic
1168072323 19:53959981-53960003 TGCCAGGGAGAAGAGAGCTGGGG - Intergenic
925892994 2:8451158-8451180 TGCCATGCTGATGTGACGGGAGG + Intergenic
926860545 2:17304214-17304236 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
927054191 2:19354955-19354977 AGCCACACTGAAGTGACCAGGGG + Intronic
927951714 2:27174781-27174803 AGACAGGCTGCAGTGAGCTGTGG + Intergenic
928548698 2:32351550-32351572 TCCCAGGCTGAAGTGCAGTGGGG + Intergenic
929488452 2:42375289-42375311 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
929630732 2:43459174-43459196 GGGCAGCCTGAAGTGAGCTGGGG - Intronic
930036317 2:47087493-47087515 TGCTAGGCTGAGGTCACCGGGGG - Intronic
930127447 2:47813469-47813491 TGCCAGGCTGGAGTGTGCAGTGG + Intronic
931309144 2:61062089-61062111 TTCCAGGCTGCAGTGACCCCTGG + Intergenic
931707014 2:64954945-64954967 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
932353420 2:71049601-71049623 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
933446538 2:82387197-82387219 TGGCAGGCTCAAGTGTTCTGGGG + Intergenic
935408943 2:102738548-102738570 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
935725683 2:106021903-106021925 TGCCAGGCTGATCTGACAGGAGG - Intergenic
936096485 2:109534102-109534124 CTCCAGGCAGAAGTGAGCTGAGG - Intergenic
936348736 2:111696428-111696450 TGCCAGGCTGGAATGAGTTGAGG + Intergenic
937317749 2:120942707-120942729 TCCCAGGCAGGAGTGAGCTGAGG + Intronic
937623989 2:124023787-124023809 ATCCAGGCTGAGGTGACCTAAGG - Intergenic
938006437 2:127790676-127790698 TTCGAGGCTGCAGTGAACTGTGG - Intronic
938182645 2:129196883-129196905 CTCCATGCTGAAGTCACCTGGGG + Intergenic
938415377 2:131099711-131099733 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
939208916 2:139145820-139145842 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
940869507 2:158848240-158848262 TTCTGGGCTGAAGTGCCCTGGGG - Intronic
940872181 2:158869238-158869260 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
940874390 2:158885226-158885248 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
941816764 2:169803655-169803677 TTTCAGGCTGCAGTGAGCTGTGG + Intronic
942817663 2:180071163-180071185 TGCCAGTCTGGAGTGAACTAGGG + Intergenic
943486052 2:188483963-188483985 GGCCAGGCTGGAGTGCACTGGGG + Intronic
943548791 2:189312668-189312690 TGCCAGCCTGAACACACCTGTGG - Intergenic
944048162 2:195437636-195437658 TTCACAGCTGAAGTGACCTGCGG - Intergenic
944255663 2:197621094-197621116 TGTCACACTGAAGTGACCAGTGG + Intronic
945433040 2:209787395-209787417 TGCAAGGGTCAAGTGACCTTGGG + Intronic
946039484 2:216771525-216771547 TCCCAGGCTGAAGTGTAGTGGGG + Intergenic
947426575 2:229988766-229988788 TGGGAGGCTGAGGTCACCTGAGG - Intronic
947994507 2:234515693-234515715 TGCCAGGCAGAGGTGTCATGTGG + Intergenic
948975357 2:241460347-241460369 TACAAGGCTGCAGTGAGCTGTGG - Intronic
1168797957 20:624151-624173 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1169649708 20:7853466-7853488 TGCCTGGCTGAAGTGAGCTTTGG + Intergenic
1171044186 20:21795163-21795185 TGGGAGGCTGCAGTGAGCTGTGG + Intergenic
1171283927 20:23922489-23922511 GGCAAGACTGAAGTGAGCTGGGG - Intergenic
1171408528 20:24930102-24930124 CTCTAGGCTGAAGTGCCCTGGGG - Intergenic
1172341455 20:34161261-34161283 TCCCAGGCTGAAGTGCAGTGAGG + Intergenic
1174234893 20:49081349-49081371 TTCAAGGCTGCAGTGAGCTGTGG - Intronic
1174473008 20:50774702-50774724 TTCGAGGCTGCAGTGAGCTGTGG - Intergenic
1174554377 20:51383275-51383297 TGGCAGCCTGCAGTCACCTGTGG - Intergenic
1174910089 20:54598366-54598388 TGCCAGTCTGATGTGCCGTGAGG - Intronic
1175105346 20:56610977-56610999 TGTGAGGCTGCACTGACCTGGGG - Intergenic
1175816340 20:61884935-61884957 CTCCAGGCTGAAGGGACCTGGGG - Intronic
1176014508 20:62923067-62923089 TTCCAGGCTGTAGTGAGCCGTGG - Intronic
1177434778 21:21037096-21037118 GTCCAGGCTGGAGTGAGCTGTGG - Intronic
1178123198 21:29490449-29490471 TGCTAAATTGAAGTGACCTGGGG + Intronic
1178285582 21:31322843-31322865 CGCCTGGCTGAAGTGACCAGTGG - Intronic
1178316862 21:31574128-31574150 TGCCAGACTGGAGTGTCCTGGGG - Intergenic
1178435585 21:32555143-32555165 GGTCAGGCTGCAGTGAGCTGTGG - Intergenic
1178447699 21:32660649-32660671 TTCTGGGCTGAAGTGCCCTGTGG - Intronic
1178511798 21:33211518-33211540 TTTGAGGCTGCAGTGACCTGTGG + Intergenic
1179008010 21:37531518-37531540 TCCCAGGCTGGTGTGGCCTGAGG - Intergenic
1179256822 21:39723972-39723994 TCCCAGGCTCAAGTGAGATGTGG - Intergenic
1180865023 22:19113326-19113348 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1180937167 22:19633368-19633390 TCCCAGGCTCCAGTGACCTGGGG + Intergenic
1181570808 22:23767072-23767094 TGCTAGGGTGAGGTGACCTTGGG + Intronic
1182189979 22:28449338-28449360 AGCCAAGCTGTAATGACCTGTGG + Intronic
1182494425 22:30695824-30695846 TGCCAAGCAGAAGGGAACTGAGG - Intronic
1183144684 22:35979244-35979266 TTCCAGGCTGAAGAGGTCTGAGG + Intronic
1183512224 22:38243018-38243040 TGCCAGGCTGGAGTGCAGTGGGG - Intronic
1184157536 22:42678134-42678156 GTCCAGGCTGAAGTGATCTCAGG + Intergenic
1184763890 22:46561779-46561801 GGCCAGGCTGAAGTCCCCAGGGG - Intergenic
949507673 3:4742219-4742241 TGCCAGCCTTCAGTGACCTTGGG + Intronic
949518507 3:4828514-4828536 TGCCAGGCTGAGGAAACCAGAGG - Intronic
949585166 3:5430095-5430117 AGCCAGGCTGAAGGGGACTGGGG - Intergenic
949905651 3:8856270-8856292 TGCCAGTCTGAGGTGAGCAGTGG - Intronic
950359746 3:12441757-12441779 GGCCATGCTGGAGTGACCAGTGG - Intergenic
950722482 3:14893417-14893439 TTCCAGGCTGCAGTGAGCTATGG - Intronic
950988791 3:17408374-17408396 TTCAAGGCTAAAGTGAGCTGTGG - Intronic
951022793 3:17798879-17798901 TGCCAGGCTTAACTGGCCAGAGG + Intronic
951166020 3:19486027-19486049 TTCTGGGCTGAAGTGCCCTGTGG + Intronic
951537166 3:23750701-23750723 TCCCAGGCTGAAGTGCTGTGGGG - Intergenic
953616473 3:44495040-44495062 TTCAAGGCTGAGGTGACCTATGG + Intergenic
953848562 3:46448297-46448319 TTCCAGGCTGCAGTGAGATGTGG + Intronic
954658551 3:52213247-52213269 TTCGAGGCAGAGGTGACCTGTGG - Intronic
955067895 3:55548142-55548164 TGCCAGGCTGAAGTGACCTGTGG + Intronic
956295934 3:67713681-67713703 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
956586370 3:70869444-70869466 TACTAGGCTGCAGTGCCCTGAGG + Intergenic
957044408 3:75362856-75362878 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
957076205 3:75605039-75605061 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
957406265 3:79777437-79777459 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
961275097 3:125720143-125720165 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
961377423 3:126476029-126476051 TGCTGGGCTGACGTGACGTGAGG + Intergenic
961631460 3:128301923-128301945 GGCCATGCAGAAGGGACCTGGGG + Intronic
961824986 3:129594512-129594534 GGCCAGGATGTAGTGAGCTGCGG - Intronic
961876401 3:130026890-130026912 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
962509387 3:136083769-136083791 ATCCAGGCTGAAGTGATCTCAGG + Intronic
962626429 3:137229990-137230012 TGCCAGGCTGGAGCTATCTGGGG + Intergenic
963024639 3:140907123-140907145 TGCCAGGCTGAAGAGGAATGTGG - Intergenic
964522412 3:157583335-157583357 TTCTGGGCTGAAGTGCCCTGTGG + Intronic
964798664 3:160528993-160529015 GTCAAGGCTGCAGTGACCTGTGG - Intronic
966330394 3:178805695-178805717 TACCAGGCTGCAGTGAGCCGTGG - Intronic
966863724 3:184244715-184244737 TGCCAGGCTGGGGTGAGCAGGGG + Exonic
968287000 3:197514635-197514657 AGCCAGGCAGATGTGACGTGAGG - Intronic
968880299 4:3295092-3295114 GGCCAGGCCGAGGAGACCTGTGG + Intronic
968988674 4:3894096-3894118 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
969729460 4:8945426-8945448 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
969734198 4:8976067-8976089 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
969749904 4:9102094-9102116 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
969793786 4:9510133-9510155 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
972207719 4:36798222-36798244 TCACAGGCTGAAGTGCTCTGGGG + Intergenic
972639079 4:40909384-40909406 TGTCAGCCTGCAGTGGCCTGGGG - Intronic
972750296 4:41981459-41981481 TTCCAGGCTGCAGTGAGCCGTGG + Intergenic
973951267 4:56016741-56016763 TTCAAGGCTGCAGTGAACTGTGG - Intronic
974744394 4:66052108-66052130 TGCCAGGCTGAAGTGAGTCTAGG - Intergenic
976510948 4:85909657-85909679 TGCTAGGTTGAATTGACTTGTGG + Intronic
976513913 4:85942325-85942347 TGACAGGATGCAGTGAGCTGAGG + Intronic
976970040 4:91093137-91093159 TTCTGGGCTGAAGTGCCCTGAGG + Intronic
980422904 4:132586406-132586428 TGCATGGTTGAAGTGACCTCAGG - Intergenic
981509970 4:145545119-145545141 TAGCAGGCTGAATTGGCCTGTGG - Intronic
981545173 4:145886078-145886100 TTTCAGGCTGAAGTGGCGTGAGG + Exonic
981604976 4:146530519-146530541 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
982447791 4:155514160-155514182 TTCCAGGCTTCAGTGAGCTGTGG - Intergenic
983110816 4:163747306-163747328 TCCCAAGCTGTAGTGACCCGAGG + Intronic
983903993 4:173166400-173166422 TTCCAGGCTGCAGTGAGCTATGG + Intergenic
984130064 4:175863931-175863953 TTCTAGGCTGCAGTGAGCTGTGG + Intronic
984357757 4:178686034-178686056 CGCCAGGCTGAAGTGCAGTGGGG + Intergenic
984635463 4:182105143-182105165 GTCCAGGCTACAGTGACCTGTGG + Intergenic
984955462 4:185041016-185041038 TGTCATCCTGAAGTGACATGAGG - Intergenic
985272779 4:188209756-188209778 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
985339396 4:188933252-188933274 TGGCATGCTGTACTGACCTGTGG + Intergenic
985485316 5:145426-145448 TTCGAGGCTGCAGGGACCTGTGG - Intronic
985937591 5:3108664-3108686 TTCCAGGCTGAAGTGACATTTGG - Intergenic
985946484 5:3188778-3188800 GGCCAGCCTGAACTGACCTCAGG + Intergenic
987598006 5:20026240-20026262 TGCCAGGCAGATGAGATCTGTGG + Intronic
989636741 5:43544073-43544095 TTCAAGGCTGCAGTGAGCTGTGG + Intronic
989965155 5:50458581-50458603 TGCAAGGCAGCAGTGAGCTGGGG - Intergenic
990046731 5:51441931-51441953 CGCCAGGCTGAAGTGCAGTGGGG - Intergenic
991729566 5:69571299-69571321 TGCCAGGCTGGAGTGCAATGGGG - Intronic
991806001 5:70426439-70426461 TGCCAGGCTGGAGTGCAATGGGG - Intergenic
991865385 5:71056581-71056603 TGCCAGGCTGGAGTGCAATGGGG + Intronic
992319826 5:75602481-75602503 TGCAGGGCTGGAGTAACCTGAGG + Intergenic
993011630 5:82489755-82489777 AGCTGGGCTGAAGTGACCTGAGG - Intergenic
993284031 5:85966415-85966437 TGCCAGGCTGAGCTCAACTGAGG + Intergenic
993839290 5:92857195-92857217 TTCAAGGCTGTAGTGAGCTGTGG - Intergenic
995473817 5:112528517-112528539 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
997962110 5:138330547-138330569 TCCCAGGCTGAAGTGCAGTGAGG + Intronic
999977708 5:156928254-156928276 TGCCAGGCTGAAGTGCAGTGGGG - Intronic
999999136 5:157120672-157120694 TGCCAGACAGGAGTGGCCTGTGG - Intronic
1001510848 5:172320701-172320723 TTCCAGGCTGCAGTGAGCTATGG - Intergenic
1001882010 5:175252642-175252664 AGGCAGGCTGAAGTGCCCAGGGG - Intergenic
1003524075 6:6883832-6883854 TTCGAGGCTGCAGTGAGCTGTGG + Intergenic
1004300333 6:14451970-14451992 TTCCAGGCTGCAGTGAGCTTTGG - Intergenic
1004853768 6:19727632-19727654 TGCCAGGCTGGAGTGCTATGTGG - Intergenic
1004936209 6:20510850-20510872 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1005764748 6:28999945-28999967 AGCCAGGCCCAAGTGAGCTGAGG - Exonic
1005776603 6:29138916-29138938 TGACAGGGTGCAGTAACCTGGGG + Intergenic
1005976240 6:30802081-30802103 TGCTAGGCTGTAGGGACCCGTGG + Intergenic
1006112112 6:31753768-31753790 GCCCAGGCTGAAGTGCCATGGGG + Intronic
1007043747 6:38750695-38750717 TGCAAGGCTGCAGTGAGCTATGG + Intronic
1007263599 6:40581168-40581190 TGCCAGACAGCACTGACCTGAGG - Intronic
1007720742 6:43884139-43884161 GGCCAGGCTGAGCTGAACTGGGG - Intergenic
1008282052 6:49608419-49608441 TGCCAGGCTAGAGTGAAGTGAGG + Intronic
1011465194 6:87648157-87648179 TGCCAGGCTGGAGTGCAGTGAGG - Intronic
1012638830 6:101582504-101582526 TGCAAGGCTGAGGAGACCTCAGG - Intronic
1013152033 6:107455712-107455734 CGCCAGGCTGGAGTGCCCAGTGG - Intronic
1014804455 6:125813349-125813371 TTCCAGGGTAAAGTGAGCTGAGG - Intronic
1015826559 6:137318679-137318701 TTCCAGAATGAAGTGTCCTGTGG - Intergenic
1015940870 6:138450637-138450659 TGTCATGCTGGAGTGATCTGTGG - Intronic
1015947197 6:138514853-138514875 TTCGAGGCTGCAGTGAGCTGTGG + Intronic
1015968915 6:138723687-138723709 GGCCAGGCTGCTGTGACCTCAGG + Intergenic
1016675071 6:146755566-146755588 CGCATGGCTGAAGAGACCTGAGG - Intronic
1018982804 6:168613452-168613474 TGCCAGGCGGAAGAGCTCTGGGG - Intronic
1019094698 6:169569835-169569857 TTCCAGTCTGAAGTGACTTGGGG + Intronic
1019216802 6:170449032-170449054 TGGCAGGCTGCAGAGACCTGTGG - Intergenic
1019284703 7:217654-217676 GGCCAGGCAGAGGTGCCCTGAGG + Intronic
1019699386 7:2466699-2466721 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1020307042 7:6843366-6843388 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1020311518 7:6872210-6872232 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1021166227 7:17345269-17345291 TGCCAGGCTGGAGTGCAGTGGGG - Exonic
1021908080 7:25355497-25355519 ACCCAGGCTGCAGTGAGCTGAGG + Intergenic
1022037216 7:26545919-26545941 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1022465774 7:30652550-30652572 TGCCTGGGTGACTTGACCTGAGG + Intronic
1022904280 7:34840736-34840758 GGTCTGGGTGAAGTGACCTGGGG + Intronic
1023432930 7:40113388-40113410 TTGCAGGCTGCAGTGAGCTGTGG + Intergenic
1024343665 7:48291670-48291692 TGCCCGGGTTATGTGACCTGAGG + Intronic
1024534276 7:50417225-50417247 AGCCAGGCTGACTTGCCCTGGGG - Intergenic
1026604517 7:71804438-71804460 TTCCAGGCTTTAGTGAGCTGTGG + Intronic
1027159613 7:75792671-75792693 TTCAAGGCTGCAGTGAGCTGTGG + Intergenic
1027386444 7:77663901-77663923 GGTCAGGCTGGAGTGACCTCAGG - Intergenic
1027594390 7:80154528-80154550 TTCCAGACTGAAGTTATCTGGGG + Intronic
1028053783 7:86218680-86218702 TGCCAGGCTGGAGTGCAGTGTGG - Intergenic
1029078196 7:97952310-97952332 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1029197430 7:98815342-98815364 TTCAAGGCTGCAGTGACCTGTGG + Intergenic
1029232062 7:99078632-99078654 TGCCCGGCTGATGTGACAGGAGG - Intronic
1030240512 7:107318067-107318089 TGCCAGGCTGGAGTGCAGTGGGG + Intronic
1030842466 7:114373032-114373054 TCCCAGGCTGAAGTGCAGTGCGG + Intronic
1032170755 7:129582699-129582721 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1032327663 7:130946406-130946428 TTCCAGGCTGCAGTGAGCTATGG + Intergenic
1032533849 7:132644439-132644461 TGCCAGGCAGAAGAGCCATGGGG - Intronic
1033719193 7:144039127-144039149 TGCTAGTCTGAAGTTTCCTGAGG - Intergenic
1034144669 7:148858401-148858423 TTCCAGGCTGCAGTGAGCTACGG - Intronic
1035179566 7:157079337-157079359 TGCCGGGCTGCAGTGACTTTCGG + Intergenic
1035412267 7:158654322-158654344 TGCCAGGCTGACTTTCCCTGTGG - Intronic
1035938489 8:3869061-3869083 TGCCACGCTGACATGACCTTAGG + Intronic
1036239815 8:7072193-7072215 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1036262063 8:7248961-7248983 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1036304527 8:7590597-7590619 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
1036314102 8:7707500-7707522 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1036355380 8:8038589-8038611 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
1036816628 8:11907424-11907446 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1036964170 8:13277242-13277264 TTCCAGGCTGCAGTGACCTGTGG + Intronic
1037751228 8:21683670-21683692 TGGGAGGCTGCAGTGACATGAGG - Intergenic
1037819765 8:22130028-22130050 CGCCAGGCTGAAGTTTCCAGCGG - Intronic
1038005060 8:23423149-23423171 TGCCAGGCTGCAGTGCAGTGGGG + Intronic
1038271654 8:26080683-26080705 TGCCACGCTGGTGTGGCCTGAGG - Intergenic
1039132964 8:34288334-34288356 TTCCAGGCTGCAGTGAGCTATGG + Intergenic
1039278367 8:35956142-35956164 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1039805754 8:40996500-40996522 TTCCAGGCTGCAGTGAGCAGTGG - Intergenic
1040468869 8:47719655-47719677 AGCCAGGCTGGAGGGACCAGGGG + Intronic
1045733511 8:105268096-105268118 TCACAGGCTGAAGTGCTCTGGGG - Intronic
1045800704 8:106097404-106097426 AGCCAGGCTGTAGTCACCTCAGG + Intergenic
1045937262 8:107695098-107695120 TCCCAGGCTTAACTGGCCTGGGG + Intergenic
1047177390 8:122554689-122554711 TGCCAGGCTGGAGTGCAGTGGGG + Intergenic
1047291227 8:123532099-123532121 TGCCTGTCTTAGGTGACCTGGGG + Intronic
1047928052 8:129700515-129700537 TTTGAGGCTGCAGTGACCTGTGG - Intergenic
1048202148 8:132383392-132383414 TGCCAGCCTGCAGGGATCTGGGG + Intronic
1048430612 8:134367153-134367175 TGCCAGTCTGATGTGACCCAGGG + Intergenic
1048957389 8:139548270-139548292 TTCTGGGCTGAAGTGCCCTGGGG + Intergenic
1049434305 8:142579395-142579417 TCCCATGCTGCAGTGACCAGCGG - Intergenic
1049647799 8:143743877-143743899 TGCCAGGCTGGAGTGCACTGGGG + Intergenic
1049671097 8:143870238-143870260 TGGCAGGCTGAAGCGGGCTGAGG - Exonic
1049949447 9:630178-630200 TTCGAGGCTGCAGTGAGCTGAGG + Intronic
1049977787 9:876308-876330 GGCCAGTGGGAAGTGACCTGGGG + Intronic
1050685058 9:8159273-8159295 TGCCAGGCTGGAGTGCAGTGGGG + Intergenic
1050761000 9:9070979-9071001 TTCGAGGCTGCAGTGAGCTGGGG - Intronic
1050823953 9:9919858-9919880 TGCCAGGATTGAGTGACATGTGG + Intronic
1051427500 9:16948283-16948305 TGCCAGGCTGGAGTGCAGTGGGG + Intergenic
1051547065 9:18288753-18288775 CATCAGGCTGAAGAGACCTGAGG - Intergenic
1051833355 9:21306601-21306623 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
1054928431 9:70611524-70611546 TGCATGGCTGAAGAGACCTTGGG - Intronic
1055592325 9:77829989-77830011 TGCCAGGCTGAAGTGAGTACAGG + Intronic
1055769934 9:79706110-79706132 TTCAAGGCTGCAGTGAACTGTGG - Intronic
1056119129 9:83469951-83469973 TCCCAGGCTGAAGAGCTCTGGGG + Intronic
1056810074 9:89757329-89757351 TCCCAGGCACAAGAGACCTGGGG - Intergenic
1056865830 9:90226697-90226719 TTCTGGGCTGAAGTGGCCTGGGG - Intergenic
1056917189 9:90756205-90756227 TTCTGGGCTGAAGTGGCCTGGGG + Intergenic
1057043885 9:91869123-91869145 TTCCAGGCTGCAGTGAGCTATGG - Intronic
1057663386 9:97023836-97023858 TGCGAGACAGAATTGACCTGAGG - Intergenic
1059074545 9:111178625-111178647 TTCCAGGCTGGCTTGACCTGAGG + Intergenic
1060171779 9:121467746-121467768 TGCCAGGCTGAATTGAAATTAGG - Intergenic
1060270322 9:122135655-122135677 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1060932881 9:127499883-127499905 TGCCAGGCTGGAGTGCAGTGTGG - Intronic
1060950388 9:127598327-127598349 TTCCAGGCTGCAGTGAGCTATGG + Intergenic
1061236401 9:129345549-129345571 TTCAAGGCTGCAGTGAGCTGTGG - Intergenic
1061646811 9:132009644-132009666 TGTAAGGCTGCAGTCACCTGAGG - Intronic
1062004813 9:134233838-134233860 AGCCAGGCTGGCCTGACCTGTGG + Intergenic
1062168731 9:135122478-135122500 GGCCAGGAGGAAGGGACCTGGGG - Intergenic
1062224104 9:135439358-135439380 TTCTGGGCTGAAGTGCCCTGGGG + Intergenic
1185909950 X:3972052-3972074 TTCTGGGCTGAAGTGCCCTGTGG - Intergenic
1186439571 X:9574129-9574151 TCCCAGGCTGAACTCACCAGAGG - Intronic
1188777257 X:34235292-34235314 GTCCAGGCTGTAGTGAGCTGTGG + Intergenic
1189410146 X:40763083-40763105 TTCCAGGCTGCAGTGAGCTATGG - Intergenic
1189885893 X:45543963-45543985 TGCATGGCTGAAGAGACCTCAGG - Intergenic
1189890143 X:45592246-45592268 TCTCAGGCTGGAGTGCCCTGGGG - Intergenic
1189937321 X:46083016-46083038 TTCAAGGCTGCAGTGAGCTGAGG - Intergenic
1190414886 X:50171381-50171403 TTCCAGGCTACAGTGAGCTGTGG - Intergenic
1190425857 X:50334081-50334103 TTCTGGGCTGAAGTGCCCTGTGG + Intronic
1190540540 X:51473529-51473551 TGGCAAGCTGAAATGACCAGAGG - Intergenic
1191036048 X:56027573-56027595 TTCTGGGCTGAAGTGCCCTGAGG + Intergenic
1192035981 X:67563571-67563593 AGCCAGGCAGCAGTGGCCTGGGG - Intronic
1192750954 X:73990483-73990505 GCCCAGGCTGAAGTGAAGTGGGG - Intergenic
1192937385 X:75874407-75874429 TGCCAAACTATAGTGACCTGCGG + Intergenic
1193936041 X:87623333-87623355 TGCCAGGCTGGAGTGCAGTGGGG + Intronic
1195386538 X:104318854-104318876 TGCCAGACGGAAGTAACCTTTGG + Intergenic
1196819520 X:119692039-119692061 AACCATGTTGAAGTGACCTGAGG - Intronic
1197746758 X:129936696-129936718 TGACAGGCTGAGGTGGCATGGGG + Intergenic
1198970055 X:142269807-142269829 TTCTGGGCTGAAGTGCCCTGAGG - Intergenic
1200941841 Y:8791029-8791051 TGCCAGGCTGGAGTGCAGTGGGG - Intergenic
1200943369 Y:8807597-8807619 TTCTGGGCTGAAGTGTCCTGTGG - Intergenic
1200948276 Y:8867281-8867303 TTCTGGGCTGAAGTGCCCTGGGG - Intergenic
1201369486 Y:13246184-13246206 AGGCAGGCCGAAGTCACCTGTGG - Intergenic
1202174298 Y:22083567-22083589 TGCCACCCTGCAGTGGCCTGTGG + Intronic
1202217062 Y:22502815-22502837 TGCCACCCTGCAGTGGCCTGTGG - Intronic
1202326123 Y:23693255-23693277 TGCCACCCTGCAGTGGCCTGTGG + Intergenic
1202342636 Y:23886054-23886076 CGCCACCCTGCAGTGACCTGCGG + Intergenic
1202528133 Y:25784031-25784053 CGCCACCCTGCAGTGACCTGCGG - Intergenic
1202544648 Y:25976799-25976821 TGCCACCCTGCAGTGGCCTGTGG - Intergenic