ID: 955069073

View in Genome Browser
Species Human (GRCh38)
Location 3:55557228-55557250
Sequence GTGGCAGATGGCCCCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955069073 Original CRISPR GTGGCAGATGGCCCCCCCAG TGG Intronic
900305942 1:2008091-2008113 GTGGCCGGTGGCTACCCCAGTGG + Intergenic
900403439 1:2482330-2482352 TGGGCTGATGGCCCTCCCAGGGG - Intronic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
900707324 1:4088894-4088916 GGGGCTGATGGGGCCCCCAGGGG + Intergenic
903856272 1:26339305-26339327 GTGGCAGATGCCACCTGCAGGGG + Exonic
915550886 1:156633414-156633436 GTGGCAGATGCAGCTCCCAGAGG - Intergenic
916069653 1:161162439-161162461 GTGGCAGATGGACCTGCAAGTGG - Intronic
918145002 1:181748199-181748221 GTGACAAATAGCCCCCCCAGTGG + Intronic
919809297 1:201398990-201399012 CTGGGATATGGCCCCCCCTGTGG - Intronic
922478176 1:225921285-225921307 GTGGATGGTGGCTCCCCCAGGGG + Exonic
923141430 1:231163574-231163596 CTGGCAGATGGCCACCGCCGCGG - Exonic
1064454511 10:15474133-15474155 TTGGCTGAAGGCCTCCCCAGTGG - Intergenic
1066431364 10:35354970-35354992 GTGGAAAATGGCCACCCCAGTGG + Intronic
1067066998 10:43109975-43109997 CTGGCAGATGGCCCCTGAAGAGG - Intronic
1067106597 10:43370913-43370935 GTGGCCGATGGGCACCCCCGGGG - Intergenic
1069307512 10:66989216-66989238 GTAGCAGAGGGCCCTCCTAGGGG + Intronic
1069597353 10:69681106-69681128 CTGGAAGATGGGACCCCCAGTGG + Intergenic
1073463446 10:103679717-103679739 GTTGGCAATGGCCCCCCCAGGGG - Intronic
1076747752 10:132522928-132522950 CTGGCCGAGGGCCACCCCAGGGG + Intergenic
1077307587 11:1874966-1874988 GGGGCAGCTGCCCCCCACAGCGG + Intronic
1077322419 11:1948203-1948225 GTGGCAGGTGGGACCCCCAGTGG + Intronic
1077327284 11:1969283-1969305 GGGGCAGGAGGCCCCCCAAGCGG - Intronic
1081152751 11:39652258-39652280 GGGGCAGCTGCCCCCACCAGCGG + Intergenic
1081814995 11:45934076-45934098 ATTGGAGATGGCCCCCACAGTGG + Exonic
1083443446 11:62691619-62691641 GTGGCATATGGCCCTCCCACAGG - Intronic
1083613541 11:64015562-64015584 GAGGCAGATGGCCCCCGCCACGG + Intronic
1083685320 11:64371739-64371761 TGGGCAGAAGGCCCCTCCAGGGG + Exonic
1084220699 11:67675772-67675794 GAGGCAGTGGGCCTCCCCAGTGG - Intronic
1084482741 11:69431315-69431337 GAGGCAGATGGCCAGGCCAGAGG - Intergenic
1084704209 11:70806498-70806520 GTTGACAATGGCCCCCCCAGAGG + Intronic
1090435852 11:126685831-126685853 GGGGCAGATGGCCGACCCACTGG + Intronic
1202805437 11_KI270721v1_random:3516-3538 GTGGCAGGTGGGACCCCCAGTGG + Intergenic
1202810266 11_KI270721v1_random:24463-24485 GGGGCAGGAGGCCCCCCAAGCGG - Intergenic
1091398772 12:170470-170492 GGGGAAGCTGGCACCCCCAGGGG + Intronic
1093994399 12:25625844-25625866 GTGGCAGGAGGCCACCACAGTGG - Intronic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094846022 12:34361757-34361779 GAGGCAGAGGCCCCCCCCACGGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094852566 12:34388811-34388833 GAGGCAGAGGTCCCCCCCACGGG - Intergenic
1094852645 12:34389173-34389195 GAGGCAGATTTCCCCCCCAACGG + Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094853574 12:34393093-34393115 GCGGCAGAGGTCCCCCCCACGGG + Intergenic
1094853802 12:34394030-34394052 GAGGCAGAAGTCCCCCCCACGGG + Intergenic
1094870973 12:34599172-34599194 GTGGCAGAGTTCCCCCCCAGGGG + Intergenic
1094871143 12:34599898-34599920 GCAGCAGATGTCCCCCCCAAGGG + Intergenic
1099735449 12:86562557-86562579 GGGGCAAATGACCTCCCCAGAGG + Intronic
1101399169 12:104373243-104373265 GTGGGAGCTGGCTCCCACAGGGG - Intergenic
1103561373 12:121794769-121794791 GTGGCAGAGGGACCCCCCCCTGG + Intronic
1104421027 12:128635596-128635618 GTGGCAGGTGGCCCCTCAAAGGG - Intronic
1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1113591842 13:111506888-111506910 GAGGCAGATGGTGCCCTCAGGGG - Intergenic
1117491377 14:56251078-56251100 CTGGGAGATGGTGCCCCCAGGGG - Intronic
1117574654 14:57085913-57085935 GTGGCAGATGGTCCACCAGGTGG + Intergenic
1118688647 14:68316530-68316552 GTGGAAGAGGGCCCACCCACAGG - Intronic
1121432515 14:93898036-93898058 GGGGCAGATGGAGGCCCCAGAGG + Intergenic
1122012241 14:98759735-98759757 GTGGCAGATGGCTCCATCAGAGG - Intergenic
1122919519 14:104874284-104874306 GTGGCTCCTGGCCACCCCAGTGG - Intronic
1123876834 15:24631840-24631862 CTGGCAGATGGACCACTCAGAGG + Intergenic
1127322968 15:57865479-57865501 GTGGCTGGTGGCTCCCCTAGTGG - Intergenic
1128072815 15:64807937-64807959 CAGGCAGATGCCCGCCCCAGGGG - Intergenic
1128329261 15:66745122-66745144 GTGGCTGGTGGCACCCCCAGGGG + Intronic
1129253022 15:74319075-74319097 GTGGCAGATGGGGCATCCAGTGG + Intronic
1131117511 15:89804072-89804094 CTGGCAGATGGCCAGCCCTGGGG - Intronic
1134303667 16:13013259-13013281 GTGGCAGCTAGCCCCAGCAGAGG - Intronic
1136396815 16:29996944-29996966 GTGGCTGATGCAGCCCCCAGTGG + Intronic
1139592677 16:67942251-67942273 GTGGTAGATAGCACCCCTAGAGG + Intronic
1140043517 16:71424948-71424970 GTGGAATGTGGCCCACCCAGGGG + Intergenic
1140904121 16:79395937-79395959 GTGGCAAATGGCCCCCCCGGTGG + Intergenic
1143682872 17:8490662-8490684 GTGGCAGGGGGCCGGCCCAGGGG - Intronic
1144203846 17:12965168-12965190 GTGGCAGATCGCCGGCCCATCGG - Intronic
1145999618 17:29123297-29123319 GTGGGGGATGGGCACCCCAGTGG + Intronic
1147638953 17:41982194-41982216 GTGGCAGTTGGCCTGCCCTGCGG + Intronic
1148201826 17:45754210-45754232 GCGGCAGCTGGCTCCCACAGTGG - Intergenic
1152021504 17:77782172-77782194 GGAACAGACGGCCCCCCCAGGGG + Intergenic
1152366498 17:79859697-79859719 GTGGCTCTTGGCCCCCACAGTGG + Intergenic
1152741186 17:82019171-82019193 GTGGCTGAGGCCACCCCCAGAGG - Exonic
1152804507 17:82348658-82348680 GTGGCAGCCGGCCAGCCCAGGGG - Intergenic
1152804524 17:82348718-82348740 GTGGCAGCCGGCCAGCCCAGGGG - Intergenic
1154423235 18:14252650-14252672 GTGACAGAGGGCCCCTCCTGGGG + Intergenic
1156459985 18:37316207-37316229 ATGGCAGCTGGCCCCCTCAGAGG - Intronic
1157818265 18:50746829-50746851 GTGGCAGATGTCTCCCCAAATGG + Intergenic
1161849904 19:6732881-6732903 CTGGCGGATGGCCCTCCCACAGG + Intronic
1162248630 19:9424116-9424138 GAGGAAAATGCCCCCCCCAGGGG + Intronic
1166347086 19:42173323-42173345 GGGACAGATGGCCACACCAGGGG - Intronic
1166718691 19:44985368-44985390 GTGACAGATGACAGCCCCAGTGG - Intronic
924958493 2:11775-11797 GTGGCAGCTGGCTCCCCCGCTGG + Intergenic
926151585 2:10428536-10428558 GTGGCATCTGCCTCCCCCAGAGG + Intergenic
926996416 2:18740719-18740741 GTGACAGAGGGCCCAGCCAGCGG - Intergenic
927516496 2:23674816-23674838 GAGGTAGTTGGCCCCACCAGGGG - Intronic
928446981 2:31341251-31341273 GTGGCAGGTGGCCCCAGGAGGGG + Intronic
929594872 2:43169735-43169757 GTGGCAGATGGACCACCTTGAGG - Intergenic
934765769 2:96879291-96879313 GTGGCAGATGACCAGCCCCGAGG + Intronic
935715054 2:105932231-105932253 GTGGCAGATGTCCCCCCCAGTGG + Intergenic
938547987 2:132352706-132352728 GAGGCAGGTGGCACCACCAGGGG + Intergenic
939961385 2:148568975-148568997 GGGGCTGGTGACCCCCCCAGAGG + Intergenic
946016674 2:216609615-216609637 GTGGCAGCTGACCCCTTCAGAGG + Intergenic
946717027 2:222563528-222563550 GTGTGAGAAGGCCCTCCCAGAGG + Intergenic
947613131 2:231536171-231536193 GGGGCAGATTCCCCACCCAGTGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170279861 20:14634075-14634097 GTGGGAAATGGCACGCCCAGGGG - Intronic
1171876855 20:30585479-30585501 GAGGCAGGTGGCACCACCAGGGG + Intergenic
1173594249 20:44248289-44248311 GTGGGAGATTGCGCCCCTAGAGG - Intronic
1175104457 20:56604642-56604664 GTGGCAGTTGGGACCCCCATGGG - Intergenic
1175488983 20:59365833-59365855 GCGGCTGATGGCCCCTCAAGTGG - Intergenic
1176019876 20:62957170-62957192 TGGGCAGAAGACCCCCCCAGAGG + Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1181937783 22:26450991-26451013 GTGGCAGATGGCTGGCACAGAGG + Intronic
1182134089 22:27884215-27884237 TTTGCAGATGTCCCCCCCAGGGG - Intronic
1183376938 22:37470924-37470946 GTGGCAGATCACTCCCGCAGAGG - Intronic
1183511263 22:38236406-38236428 GGGGCAGATGGGACTCCCAGGGG + Intronic
1183603364 22:38853052-38853074 CAGGCAGATGAGCCCCCCAGAGG + Intergenic
1184693001 22:46125825-46125847 AGGGCACATGGCCCGCCCAGGGG - Intergenic
1185158485 22:49208335-49208357 GTGGCTGATGGACCCCACAGAGG - Intergenic
1185363476 22:50423310-50423332 CTGGCAGACGGCCCTCCCTGAGG + Intronic
950159925 3:10752769-10752791 TTGGCTGACGGCCCTCCCAGAGG + Intergenic
950542163 3:13619113-13619135 GTGCAAGATGGCCCCTCCAAAGG + Intronic
952550551 3:34471937-34471959 GTGGCAGATGCCCCTCCCCCAGG + Intergenic
952956566 3:38561314-38561336 GTGGCCAATGGCCACCGCAGAGG + Intronic
954689784 3:52389580-52389602 GTGGCAGGTGCCCACCCCAGGGG + Exonic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
970194073 4:13539308-13539330 GTGGAAGATGGAGCCGCCAGGGG + Intergenic
972677860 4:41277558-41277580 GTGGGTGATTGCCACCCCAGAGG + Intergenic
985132209 4:186750083-186750105 GTGCCAGCTGGCCTTCCCAGTGG + Intergenic
985534251 5:454438-454460 CTGGCACATGGCCACCCCACTGG + Intronic
985689126 5:1297401-1297423 CTGGCAGATGGCAACCCCACTGG + Intergenic
985765734 5:1778489-1778511 GTGGAAACTGGCCCCCCGAGGGG - Intergenic
986729328 5:10623670-10623692 TTGGGAGCTGGCCCACCCAGGGG + Intronic
987080060 5:14418242-14418264 GAGGCAAAGGTCCCCCCCAGTGG - Intronic
988132355 5:27121180-27121202 GAGCCAGATGGCCCCCTCTGGGG + Intergenic
997259894 5:132457654-132457676 GTGGCAGCTGGGCTTCCCAGGGG - Intronic
998548939 5:143057920-143057942 ATGCCAGATGGCCTTCCCAGAGG + Intronic
998690778 5:144584998-144585020 GTGCAAGATTGCCCCCCAAGTGG - Intergenic
999152556 5:149435898-149435920 GTGGAAGATGGTGCCTCCAGAGG - Intergenic
999319086 5:150602143-150602165 GTGGCAAATGGGGCTCCCAGAGG + Intronic
1001663433 5:173413355-173413377 TTGGCTGAGGGCCACCCCAGAGG + Intergenic
1003967231 6:11264295-11264317 GAGTGAGATGGCGCCCCCAGAGG + Intronic
1006338160 6:33431712-33431734 GTGGAAGATGTGCCCACCAGGGG + Intronic
1008816915 6:55579229-55579251 GTGGCAGGTGGCCGCGCCTGGGG + Intergenic
1019595459 7:1856389-1856411 GAGGCAGGGGGCCCCCACAGAGG - Intronic
1019625577 7:2014156-2014178 TTGGCAGATGCCCCTCACAGGGG + Intronic
1019896991 7:3990322-3990344 GTTGCAGAGGCCCCCCGCAGGGG - Intronic
1023875547 7:44284465-44284487 CTGGCAGATGGCACGCCCTGGGG + Intronic
1024270883 7:47640471-47640493 GTGGCAGCTTGCCCCCACTGGGG + Intergenic
1024627324 7:51219410-51219432 GTGGCTGCTGTCCCACCCAGGGG + Intronic
1025139224 7:56448610-56448632 CTGGCACGTGGCCCCTCCAGGGG + Intergenic
1025239225 7:57257272-57257294 CTGGCACATGGCTCCTCCAGGGG + Intergenic
1026636939 7:72091724-72091746 GTGGCAGATGCCGTACCCAGAGG + Intronic
1027427102 7:78072063-78072085 GTGGCTGATGGCCACCGGAGGGG + Intronic
1029008197 7:97231978-97232000 ATGGCAGATGACACCCCCTGGGG + Intergenic
1032474978 7:132205428-132205450 GAGGCAGATGACTGCCCCAGTGG + Intronic
1033618732 7:143042495-143042517 GTAGCAGATGGTCACCCCAAAGG + Intergenic
1035563511 8:626657-626679 GTGGCTGACGGCCTGCCCAGAGG + Intronic
1039476265 8:37840908-37840930 CTGGCAGATGGCCCTGCCAGTGG - Intronic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1048985455 8:139732451-139732473 GTGGCAGGAGGCCCTCCCAGAGG - Intronic
1056792208 9:89633234-89633256 GTGGCAGGTGGACCCCCAGGAGG - Intergenic
1060559459 9:124530690-124530712 GTGGCTGATGGCCACTCCTGGGG - Intronic
1061245590 9:129399891-129399913 GTGGCAGAGGGAGACCCCAGAGG + Intergenic
1062081527 9:134626605-134626627 AAGGCAGATGGCCACCCCACAGG + Intergenic
1062099584 9:134721249-134721271 CTGTCAGATGTCCCCCCCATGGG + Intronic
1062100825 9:134727735-134727757 GCTGCACATGGCCCCTCCAGTGG - Intronic
1187567903 X:20470709-20470731 GAGGAAGATGGCTCACCCAGTGG + Intergenic
1195352052 X:104005295-104005317 GTAGCAGATGACCCACCCACTGG - Intergenic
1196734576 X:118973311-118973333 GTGCCAGGTTGCCGCCCCAGGGG - Intergenic
1197934697 X:131728506-131728528 GTGGGAGATGGCCTCAGCAGAGG - Intergenic
1198644191 X:138788402-138788424 GGGCAAGATGGCCACCCCAGTGG - Intronic
1199763020 X:150919707-150919729 GTGGCAGGTGTGGCCCCCAGGGG - Intergenic
1200059040 X:153475947-153475969 GTGGCAGCTGAGCCCGCCAGGGG - Intronic