ID: 955072786

View in Genome Browser
Species Human (GRCh38)
Location 3:55585629-55585651
Sequence TGTTAGAGAGAGCTCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955072786 Original CRISPR TGTTAGAGAGAGCTCTTTGG GGG Intronic
901277799 1:8006225-8006247 TCTTAGAGAGAGAGCTGTGGGGG - Intronic
904115831 1:28161122-28161144 TCTTAGAAAGAGCTACTTGGAGG - Intronic
904805157 1:33126076-33126098 TGTTAGACAGTGATCTATGGAGG - Intergenic
907754061 1:57292778-57292800 TGTTAGACTGAGCTTCTTGGAGG - Intronic
908259921 1:62332285-62332307 TGTTAGAGAGAGGTCTATGGTGG + Intergenic
910397482 1:86807029-86807051 TTTTACAGAGAGCTGATTGGGGG - Intergenic
917376428 1:174352831-174352853 TTTTAGAGGTACCTCTTTGGTGG + Intronic
917950719 1:180031450-180031472 TGATACAGATAGCACTTTGGAGG + Exonic
918042421 1:180921435-180921457 TGAGAGAGAGACCTCTGTGGCGG + Intronic
918735342 1:188054980-188055002 TGGAAGTGAGAGCTCCTTGGAGG - Intergenic
920937093 1:210445699-210445721 TGTTTGAGAGAGGTGGTTGGTGG + Intronic
920988678 1:210915058-210915080 TGTTTGGGGGAGCTCTCTGGGGG - Intronic
921320386 1:213932787-213932809 TGCAAAAGAGAGCTGTTTGGGGG + Intergenic
921908278 1:220518848-220518870 TGTTAAAGAGAAGTCTTTTGTGG + Intergenic
922655129 1:227375390-227375412 TGTTAGAGAGGACTCTTCAGAGG - Intergenic
1063046992 10:2401847-2401869 TGTGAGAGAGAGCTTTTTTTTGG + Intergenic
1063279875 10:4616299-4616321 GCTTACAGATAGCTCTTTGGAGG - Intergenic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1071522318 10:86339037-86339059 GGTGAGAGATAGCACTTTGGAGG - Intronic
1071845663 10:89518755-89518777 GGAAAGAGAGTGCTCTTTGGGGG - Intronic
1072759567 10:98045272-98045294 TATTAGAGACAGCTGTCTGGTGG - Intergenic
1073182031 10:101589390-101589412 TGTAAGTGACATCTCTTTGGAGG + Intronic
1073205605 10:101767816-101767838 CGTTAGTGAGGGCTCTGTGGAGG + Intergenic
1076201652 10:128563727-128563749 TGTTTGACAGAGATCTTTCGAGG + Intergenic
1076637562 10:131892185-131892207 TGAAAGAGAGAGCTATTGGGAGG + Intergenic
1077694732 11:4383879-4383901 TGTTAGAGAGGGCTTGTTAGTGG + Intergenic
1080029592 11:27646827-27646849 TGTTAGATTGAGCTTTCTGGTGG + Intergenic
1080566484 11:33514118-33514140 TGTTCCAGATATCTCTTTGGAGG + Intergenic
1083455715 11:62777468-62777490 GGTTAGAGAAAGCTTTTTGGAGG + Intronic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1085057553 11:73415338-73415360 TGAAAGAGAGAGCTGTTTGTGGG + Intronic
1085058771 11:73425444-73425466 TTTTACAGACAGCTCTTTAGAGG - Intronic
1085061338 11:73449822-73449844 TGGTAGACAGAGACCTTTGGAGG + Intronic
1085579219 11:77636019-77636041 TATTAAAGAGAGATGTTTGGAGG - Intronic
1087182945 11:95157422-95157444 TTGAAGAGAGAGCTCTTTGAAGG - Intergenic
1088841049 11:113627721-113627743 CTTTGGAGAGAGCCCTTTGGAGG - Intergenic
1089573818 11:119427288-119427310 TGTCAGAGAGGGCTTCTTGGAGG + Intergenic
1090154425 11:124422754-124422776 TGCTAGAGGAAGATCTTTGGAGG - Intergenic
1090747573 11:129719621-129719643 TTTTAAAGAGAGCTGTTTGGGGG + Intergenic
1095970456 12:47898161-47898183 TCTCAGAGAGAGCTCTGTGCTGG - Intronic
1098863344 12:75733956-75733978 TGTGAGAGAGAGCTCTTGCTTGG - Intergenic
1101221549 12:102646621-102646643 TTTTAGAGAGACCACTCTGGAGG + Intergenic
1102630038 12:114270123-114270145 TGTGAGAGAGAGCTGTTGGCTGG + Intergenic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102689276 12:114747690-114747712 TGATAGAGAGGGTCCTTTGGAGG + Intergenic
1102942897 12:116959693-116959715 AGTTAATGAAAGCTCTTTGGTGG + Intronic
1105410764 13:20169413-20169435 TGTTAGATAAAACCCTTTGGAGG + Intergenic
1106057535 13:26252849-26252871 TATAAGAGAAAGCCCTTTGGAGG + Intergenic
1107054711 13:36090549-36090571 TCTTAGAAAGAGCTCTCTGGAGG + Intronic
1107621744 13:42239700-42239722 TTTTAGAGAGACCACTCTGGTGG - Intronic
1108777754 13:53786577-53786599 TGTGAGTGGAAGCTCTTTGGAGG - Intergenic
1111471360 13:88686671-88686693 AGTTTGAGAGACCTCTGTGGAGG - Intergenic
1113092749 13:106632240-106632262 TGTTTGAGGGAGCTCTCGGGAGG + Intergenic
1113516063 13:110900078-110900100 TTTTAGTGAAAGTTCTTTGGGGG - Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1123756902 15:23403962-23403984 TTCTAGAGAGAGATCTATGGGGG - Intergenic
1124190751 15:27574468-27574490 TGTTGCAGAAAGCTCTTTGGGGG - Intergenic
1124430493 15:29603525-29603547 TGTCAGTGAGTGCTCTTCGGGGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125773027 15:42184662-42184684 TGTTGGAAAGAGCTCTTTGATGG + Exonic
1127592617 15:60441154-60441176 TGTTGGTGTGAGGTCTTTGGAGG + Intronic
1128387154 15:67157938-67157960 TGCTAGAGAAAGACCTTTGGGGG + Intronic
1129990012 15:79953832-79953854 TATTATAGACAGCTCTTTTGAGG + Intergenic
1130982036 15:88819279-88819301 TGTTAGAGGGAGGTCTTTGAGGG + Intronic
1135349741 16:21718653-21718675 TGTTCTAGAGTGCTCATTGGGGG + Intronic
1135711180 16:24718699-24718721 AGTTAGAAAGACCTCTTTGGTGG + Intergenic
1137839497 16:51626950-51626972 TGTTGGAGGAAGCTCTTTGTGGG + Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1147357992 17:39912535-39912557 TTTTGGAGAGAGATCTTTTGGGG - Intronic
1148469218 17:47883230-47883252 TGGGAGGGAGAGCTCTATGGTGG - Intergenic
1148976516 17:51534906-51534928 TGTAACAAAGAGTTCTTTGGTGG - Intergenic
1149946553 17:60934001-60934023 TGTAAGAGAGGGATCTTTGTAGG + Intronic
1150425297 17:65072748-65072770 ATTTAGAGATAGCTCTTTAGAGG + Intergenic
1152000278 17:77640973-77640995 TGTGGGAGAGATCTCATTGGAGG + Intergenic
1152008844 17:77698302-77698324 TGTGAGAGAGAGGGCTCTGGGGG + Intergenic
1152854295 17:82655359-82655381 TGTGACTCAGAGCTCTTTGGAGG - Exonic
1153329442 18:3858334-3858356 GGTTGGTGAGAGCTCTTTGAGGG + Intronic
1153587934 18:6642867-6642889 TGTTGGCGAGAGTTCTTGGGGGG - Intergenic
1155412996 18:25566538-25566560 TGTTAGAGAAAGCTCCTTGGAGG - Intergenic
1156619121 18:38827891-38827913 TGTTAGTCAGAGTTCTTTAGAGG + Intergenic
1157489095 18:48109877-48109899 TGCTAGAGAGAAGTGTTTGGGGG - Intronic
1158558595 18:58495130-58495152 TGGTTGAGAGACCTCTTTAGAGG - Intronic
1162425731 19:10594273-10594295 TTTCAGAGAGATCTCTTTAGTGG - Intergenic
1164444802 19:28307960-28307982 TGTTAGAGAGACCTCCTGGAAGG - Intergenic
925700787 2:6635774-6635796 TGTTAGGGAGAGCTCCCTAGGGG + Intergenic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927059637 2:19404277-19404299 TGTTAGAAACAGATATTTGGTGG + Intergenic
928450874 2:31377675-31377697 GGTTAGAGAGGGCACTGTGGAGG - Intronic
931221221 2:60289780-60289802 TGAAAGAGAGAGTTCTTTGGTGG - Intergenic
931680707 2:64747341-64747363 TGTTAAACAAAGCTCTTTGAGGG - Intronic
932076678 2:68670837-68670859 GTTTAGAGAGAATTCTTTGGAGG - Intergenic
932406277 2:71514374-71514396 TGTTAGACAGAGCTTCTTTGAGG - Intronic
933149007 2:78891823-78891845 TCTTAGAGAGAGCTCTTCAATGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933483114 2:82882315-82882337 TGATAAAGAGGGCTTTTTGGCGG - Intergenic
938611220 2:132949372-132949394 AGTGAGAGAGAGCTGGTTGGAGG - Intronic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
939041269 2:137191690-137191712 GGTCAGAGAGAGCTTCTTGGAGG - Intronic
939062501 2:137439966-137439988 TGTTCCACAGAGTTCTTTGGAGG + Intronic
939967960 2:148629206-148629228 TGTCAGAGAAAGCTCTAGGGAGG - Intergenic
940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG + Intronic
940303394 2:152199660-152199682 TGTAAAAGAAAGCCCTTTGGGGG + Intergenic
940918067 2:159279914-159279936 TGTTAAAGATGGCTCCTTGGCGG - Exonic
942490252 2:176482866-176482888 TGCTGGAGAGAGGTCCTTGGGGG + Intergenic
944321142 2:198343981-198344003 TAGTAGAGAGAGCTCTTTTGAGG + Intronic
947634546 2:231673411-231673433 TGGAAGTGAGAGCTCTGTGGGGG - Intergenic
948915189 2:241030814-241030836 TGTCAGAGAGAGGTGTTAGGAGG + Intronic
1172134444 20:32677566-32677588 TGAGAGTCAGAGCTCTTTGGGGG - Intergenic
1172222250 20:33281916-33281938 GTTTTGAGAGAGCTCTTGGGAGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173015814 20:39224589-39224611 TGTTGTAGAGAGCTGTCTGGTGG + Intergenic
1173225341 20:41159383-41159405 TGTCAGAGAGGGCTATATGGGGG - Intronic
1174224371 20:48985019-48985041 TGTTGCAGAAAGCTCTTTGATGG + Intronic
1174554892 20:51387141-51387163 TGTTGGAGAGACCTGTTTGTTGG + Exonic
1175629621 20:60524289-60524311 TCTCATAGAGAGCTCTGTGGAGG - Intergenic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
951931743 3:27975115-27975137 TGCTAGAGAGAATTATTTGGGGG - Intergenic
952467444 3:33604811-33604833 TGTTATCGAGTTCTCTTTGGTGG - Intronic
952506658 3:34013093-34013115 TGTTAGAAAGAACTATTTGATGG - Intergenic
954083706 3:48227586-48227608 TGCTAGAGAGAGTTCTAGGGAGG + Intergenic
955032260 3:55232807-55232829 TGTTAGTCAGGGTTCTTTGGAGG - Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
960742079 3:120845517-120845539 TGTGAGAGAGAGCTAATGGGAGG + Intergenic
960967593 3:123116034-123116056 TGATACAGTAAGCTCTTTGGGGG + Intronic
965729452 3:171755317-171755339 CTTTGGAGAGAGCTGTTTGGTGG - Intronic
968278550 3:197458799-197458821 TGTTAAAGAGAGCCTCTTGGGGG - Intergenic
969943100 4:10754475-10754497 TGTTAGAGAGAGTCCTTTCCTGG - Intergenic
975300664 4:72787026-72787048 TGTGAGAGTGAGCGATTTGGAGG - Intergenic
975976359 4:80101340-80101362 TGTTGGAAAGAGCTCTTTACTGG - Intronic
978250268 4:106622490-106622512 TGTTCAAGAGACCTCTTTAGAGG - Intergenic
979440874 4:120748679-120748701 TGGAGGAGAGAGCTATTTGGAGG - Intronic
979601328 4:122589398-122589420 TATTAGACAGGGGTCTTTGGGGG - Intergenic
979813675 4:125071721-125071743 TGAGACAGAGAGCTCTGTGGGGG + Intergenic
980120084 4:128718698-128718720 TGTAACAGAAAGATCTTTGGAGG - Intergenic
980516058 4:133863411-133863433 CATTAGAGAGGGCTCTTTAGGGG - Intergenic
982358468 4:154493156-154493178 GGTTAAAGAGAGTTCATTGGGGG - Intergenic
984177787 4:176440767-176440789 GATTAGACAGAGCTCTTTGAAGG - Intergenic
986684513 5:10264429-10264451 TGGTAAAGAGAGCTGTTGGGAGG - Intronic
987995970 5:25279875-25279897 TCTTAGAAACAGGTCTTTGGTGG - Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
989137381 5:38168348-38168370 TTTCAGAGAAGGCTCTTTGGAGG - Intergenic
990424117 5:55668200-55668222 TTATAGAGAGAACTCTGTGGGGG + Intronic
991937726 5:71818374-71818396 TGTTATAGAGAGGACATTGGAGG - Intergenic
998106622 5:139473064-139473086 TTATAGAGAGAGCCCTGTGGTGG + Intergenic
999266142 5:150268165-150268187 TTTTAAAAAGAGCTCCTTGGTGG - Intronic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1000793721 5:165638738-165638760 TTTGAGACAGAGCTCTTTGAAGG - Intergenic
1001326914 5:170735161-170735183 TTTGAAAGAGAGCGCTTTGGGGG + Intronic
1001653731 5:173332361-173332383 TGTGAAAGAGATCTCTTTGATGG - Intergenic
1003751173 6:9058050-9058072 TCTTAGAGAAAGCTCTTGAGTGG + Intergenic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1007496232 6:42261770-42261792 GGTGAGAGAGACCTCGTTGGTGG - Intronic
1007758314 6:44115619-44115641 TTCTAAAGAGAGCTCTTTGTTGG - Intronic
1007876113 6:45103139-45103161 TGTCAGAGTGAGTTCTTTAGAGG - Intronic
1012436855 6:99224153-99224175 TGTGAGAGTGAGCTCTGAGGTGG - Intergenic
1013784689 6:113766238-113766260 TTTTAGAGGGATTTCTTTGGTGG + Intergenic
1013796267 6:113892979-113893001 TGCTACAGAGAACTCTTTTGTGG + Intergenic
1014130474 6:117826033-117826055 TGTTACAGAGAAATCTTTTGAGG + Intergenic
1014825219 6:126042381-126042403 TTGTAGACAGGGCTCTTTGGGGG + Intergenic
1016941276 6:149484681-149484703 TGTTAGAGAGCAGTCCTTGGGGG - Intronic
1018006308 6:159625487-159625509 TGTTCTTGAGAGCTCTTTGGAGG - Intergenic
1019127143 6:169848277-169848299 TGTTAGAGACAGCTGCTTGCGGG + Intergenic
1019385387 7:752687-752709 TGTTACAGAGCGGTCTTTTGAGG - Intronic
1022178609 7:27896485-27896507 TGTTGGAGAGAGGCCTTGGGGGG - Intronic
1022400465 7:30031312-30031334 TGTTAGAGAAAGCTTCTTTGAGG + Intronic
1022654172 7:32303869-32303891 TGTTATGGGGAGATCTTTGGGGG - Intergenic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1024877986 7:54047471-54047493 TGTTTGACAGATCTCTCTGGTGG - Intergenic
1027344995 7:77250327-77250349 TGTTAAAGGAAGCTCTTTAGAGG - Intronic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1027795498 7:82688248-82688270 TATTTGGGAAAGCTCTTTGGAGG + Intergenic
1028106192 7:86881727-86881749 TGTTAGAGAAAGCTTTCTGAAGG + Intronic
1028997489 7:97117423-97117445 TGAAAGAGAGAGGTCTGTGGTGG - Exonic
1030597191 7:111554315-111554337 TGTTTGAGGGAGTTCTTAGGGGG - Intronic
1032683791 7:134210476-134210498 TGTAAGAGAGAGATTTTTGGAGG + Intronic
1036130238 8:6103092-6103114 TGTTAGAGAGCTCTGTTTGCTGG + Intergenic
1045605966 8:103776290-103776312 TGTGATAGAAAGATCTTTGGTGG + Intronic
1046327868 8:112673607-112673629 TTTTAGAGAGAGTTCTTTTGAGG - Intronic
1047474172 8:125210390-125210412 TGAAAGAGAGAGCTCATTGAGGG + Intronic
1050104753 9:2153827-2153849 TGAGAGAGAGAGATCTTTGCTGG + Intronic
1050175803 9:2868327-2868349 TGTTAGACATAGCTTTTTGGGGG + Intergenic
1050838496 9:10115056-10115078 TGTGAGAGATAGCACTTTGAAGG - Intronic
1052186494 9:25602820-25602842 TGGTAGAGAGAGTTCTGTAGTGG + Intergenic
1055702965 9:78966241-78966263 TGGAAGAGAGAGGTCTTTGTGGG - Intergenic
1057424321 9:94936158-94936180 TTTTAAGGAGAGCTCTCTGGTGG - Intronic
1062475927 9:136727474-136727496 TGTGACAGTGAGCTTTTTGGTGG - Intergenic
1186728818 X:12385852-12385874 TGTTTGAAAAAGCTGTTTGGAGG + Intronic
1188294159 X:28425993-28426015 TGGAGGAGAGAGCCCTTTGGGGG - Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1191739385 X:64420712-64420734 AGTCAGAGAAAGCTTTTTGGTGG - Intergenic
1195243820 X:102978828-102978850 GGTGAGACAGTGCTCTTTGGAGG + Intergenic
1195314969 X:103668489-103668511 TCTCAAAGAGAGCTGTTTGGGGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197283270 X:124563217-124563239 TGTTAAAGGAAGCTCCTTGGAGG + Intronic