ID: 955076695

View in Genome Browser
Species Human (GRCh38)
Location 3:55620656-55620678
Sequence ACAGCTGCACAGAGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955076695 Original CRISPR ACAGCTGCACAGAGGGAACT GGG Intronic
900079414 1:844413-844435 ACATCTGCTCAGAGGGAGCCTGG - Intergenic
900154645 1:1199066-1199088 AAGGCAGGACAGAGGGAACTGGG + Intergenic
900493123 1:2962752-2962774 ACAGCTGCTGAGAGGGCGCTGGG + Intergenic
900574112 1:3374573-3374595 ACAGTCGCACAGAGGGCCCTTGG - Intronic
900981860 1:6050238-6050260 TCAGCTGCACAGTGGGATCCTGG - Intronic
901314232 1:8294922-8294944 GCAGCGGGACAGAGGGAACCTGG + Intergenic
902490118 1:16775387-16775409 TCAGGTGCACAGAAGGAGCTGGG + Intronic
904446010 1:30573462-30573484 GCAGCTACTCAGAGGGACCTGGG - Intergenic
906662265 1:47591099-47591121 CCAGGGGCACTGAGGGAACTTGG + Intergenic
910436724 1:87212892-87212914 AAAGCTGCATAGAGGAACCTGGG + Intergenic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
919976281 1:202615146-202615168 AGAGCTGCAGAGAGGGAATGTGG + Intronic
920561965 1:206945333-206945355 GCAATTGCACAAAGGGAACTGGG + Intronic
920972558 1:210755123-210755145 ACAGTGGCAGAGAGGGAAGTAGG + Intronic
922176804 1:223203337-223203359 ACATCTGCAGAGAGGGAGTTAGG + Intergenic
923530319 1:234807143-234807165 TCAGGTGCACAGAAGGAGCTGGG - Intergenic
924032569 1:239901092-239901114 GCAGCTGCTCAGAGGTCACTAGG - Intronic
1067400114 10:45965024-45965046 ACAGCTGCAGGGAGGGCATTAGG - Intergenic
1067868444 10:49934316-49934338 ACAGCTGCAGGGAGGGCATTAGG - Intronic
1068514422 10:58008453-58008475 ACAGCAACACAGAGGGAAGAAGG + Intergenic
1069861305 10:71473356-71473378 ACAGGTGCACAGAGGGCCCTTGG - Intronic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1070325309 10:75384928-75384950 AAAGGTGCTCAAAGGGAACTCGG + Intergenic
1071992378 10:91112514-91112536 GCAGCAGCACAGAAGGGACTTGG - Intergenic
1072043093 10:91628018-91628040 CCAGCTGCACAGAGGGGCATAGG - Intergenic
1073161042 10:101395344-101395366 ACAGCAGCACAGAGGGTGTTGGG - Intronic
1075806630 10:125193745-125193767 ACAGTTTCTTAGAGGGAACTTGG + Intergenic
1075829753 10:125398205-125398227 TCAGCTGCCAAGAGGGACCTCGG - Intergenic
1077050804 11:565931-565953 ACTGCTGTGCAGAGGCAACTCGG + Intergenic
1077056736 11:597606-597628 CCAGCTGCCCAGAGTGATCTCGG + Intronic
1077075397 11:698936-698958 GCTGCTGCACAGAGAGCACTCGG + Intronic
1077235061 11:1477862-1477884 ACAGATGAACAGACGGGACTGGG - Intronic
1077236219 11:1483222-1483244 CCAGCAGCACAGGGGGAGCTGGG - Intronic
1077842492 11:5990852-5990874 ACTGCAACACAGAGAGAACTAGG + Intergenic
1081720618 11:45285952-45285974 GCAGCTGCAGAGGGGGAACTGGG - Intronic
1082884053 11:58065802-58065824 TCAGCTGCTCAGAGAGAACTAGG + Intronic
1083731617 11:64655403-64655425 GCGGCTGCACAGAGGGGACAGGG + Intronic
1084215665 11:67645649-67645671 ACAGCTCCCCAGAGGGGAGTGGG - Intronic
1084465448 11:69320552-69320574 GCATCTGCACACAGGGCACTGGG - Intronic
1085154096 11:74277434-74277456 ACATCTGAACAGAGGGACCCGGG + Intronic
1085394846 11:76202047-76202069 AGAACTGCAGAGAGGGAACTTGG - Intronic
1085637629 11:78170645-78170667 ACAGCTGCACAAGGGGAAGGGGG - Intergenic
1086017581 11:82184960-82184982 GCAGATGCTCAGAGGGCACTGGG - Intergenic
1086331979 11:85763245-85763267 ATAGCAGCACAAAGGGAAATTGG + Intronic
1086823037 11:91459462-91459484 ACAGCTCCACATGAGGAACTGGG + Intergenic
1087051520 11:93890508-93890530 ACAGCTGCAAGGAGGTACCTAGG + Intergenic
1087654725 11:100908535-100908557 ACAGCAACATAGATGGAACTGGG - Intronic
1089840969 11:121417268-121417290 ACAGCTGCCCAGAGCCAACAAGG + Intergenic
1089865943 11:121631906-121631928 AAAGCTACACAGAGGGAAACAGG - Exonic
1091178260 11:133580756-133580778 ACAGATGCCCAGATGGAATTTGG + Intergenic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1093581017 12:20783993-20784015 ACAGCTGCAGAGGGTGTACTAGG - Intergenic
1093875214 12:24341845-24341867 AAAGCTGCCCAGTGGGCACTGGG - Intergenic
1096317441 12:50580634-50580656 ACAACTGAACTGAAGGAACTGGG - Intronic
1097156432 12:57015600-57015622 ACAGCTGTAGTGAGGAAACTGGG - Intronic
1099801126 12:87457591-87457613 GCAGCAGCATAGATGGAACTGGG + Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1107650506 13:42540374-42540396 ACAGATGCACAGAGTGAGGTAGG + Intergenic
1107836526 13:44416284-44416306 ACTGCAGCACAGAGGCCACTTGG - Intergenic
1108407043 13:50114938-50114960 AGAGCTCCACAGAGGGATCAGGG - Intronic
1110173537 13:72530824-72530846 ACAGCTGCAAAGAGGGAAACCGG + Intergenic
1110531198 13:76600978-76601000 ACACCGGCACAGAGGGAAGATGG + Intergenic
1111582311 13:90238641-90238663 ACAGCTGCACAGGGAGAAGGCGG - Intergenic
1112103567 13:96216687-96216709 ACAGGTGCCCAGAGGAAGCTTGG + Intronic
1112972572 13:105278884-105278906 AAAGCAGGACAGAGGGAAATGGG + Intergenic
1113430346 13:110245097-110245119 AAAGCTCCAAACAGGGAACTCGG + Intronic
1113792475 13:113036469-113036491 CCAGCTGCCCACAGGCAACTGGG + Intronic
1116079252 14:40152628-40152650 TCAGCTGCACAGTTGGAAATAGG + Intergenic
1116866023 14:50032328-50032350 ACAGATGCACAGAGAGAGCAGGG + Intergenic
1117160893 14:52988445-52988467 ACATCTGCCCAGAAGGAAATTGG - Intergenic
1120523262 14:85548987-85549009 ACAGCTTGACAGTGGGACCTTGG + Intronic
1120905240 14:89614718-89614740 AGAGCTGCTCTGAGGGAACTAGG - Intronic
1121619862 14:95338653-95338675 ACAGGAGCACAGAGAGAGCTGGG - Intergenic
1121732704 14:96197628-96197650 AAAGCGGCTCAGAGGGAACGCGG + Intergenic
1121778272 14:96605350-96605372 ACTGATACACAGAGGGAATTGGG + Intergenic
1122394571 14:101414424-101414446 ACAGAGGCACAGAGGGAAGAAGG + Intergenic
1123875423 15:24618991-24619013 ACAGCTGAACTGAAGGAAGTTGG - Intergenic
1124491928 15:30163493-30163515 AGAGCTGCAGAGAGGGAATGTGG + Intergenic
1124751609 15:32374824-32374846 AGAGCTGCAGAGAGGGAATGTGG - Intergenic
1125298017 15:38223435-38223457 ACAGCTGCTCAGAGTCAACCTGG - Intergenic
1128837887 15:70825972-70825994 ACAGCTGCCCAGCCGGAAATTGG + Intergenic
1129183798 15:73893604-73893626 ACAACTGCACAGAGGCACCGTGG + Intergenic
1129264501 15:74386625-74386647 ACAGCTGCACAGGGGGCAAGTGG + Intergenic
1129678265 15:77643850-77643872 ACAGCTGTAAACAGGGAAATGGG + Intronic
1129911674 15:79232951-79232973 TCAGCTGCATAGAAGCAACTTGG - Intergenic
1130014547 15:80176509-80176531 ACAGCTTCCCAGAGGGCCCTGGG - Intronic
1130063277 15:80584698-80584720 AGGGCTGCACAGAGGGCACTGGG - Intronic
1130906819 15:88246613-88246635 ACATTTGCACAGAGGGTAATGGG - Intronic
1131469875 15:92687516-92687538 ACAGCTGCTCAGAGGCTGCTGGG + Intronic
1131549174 15:93341940-93341962 ACAGCTGAAAAGAGGGTAGTGGG + Intergenic
1136508266 16:30720379-30720401 AAAGCTGCCCAGAGGGGCCTGGG + Intronic
1136646145 16:31617852-31617874 ACAGATACACAGAGAGAAGTGGG + Intergenic
1137559474 16:49493480-49493502 ACAGCTGCCCAGGAGCAACTTGG + Intronic
1137642023 16:50040492-50040514 ACGGGTGCTCAGAGGGAGCTGGG - Intergenic
1139678913 16:68544721-68544743 ACCTCTGGACAGAGGGAGCTCGG - Intronic
1140147350 16:72324226-72324248 AGAGCTGAACTGAGGGAAATTGG - Intergenic
1141402851 16:83765953-83765975 ACAGCTACCTAGAGGGAATTTGG + Intronic
1142029565 16:87831801-87831823 CCGCCTGCAGAGAGGGAACTAGG - Exonic
1142576361 17:911062-911084 ACATATGCACTGTGGGAACTTGG - Exonic
1142641401 17:1288085-1288107 AGAGCTGCAAAGAGGGAAGGGGG - Intronic
1142787257 17:2233871-2233893 TCAGCTGCACACTGGGTACTTGG + Intronic
1143057304 17:4171885-4171907 ACAGCTGCGCAGAGGGCTCTGGG + Intronic
1143641320 17:8199722-8199744 ATAGGTGAACAGAGGTAACTTGG + Intergenic
1144202680 17:12955523-12955545 ACTCCTGCACACAGGGAACATGG + Intronic
1146186505 17:30727817-30727839 ATAGCAGCGCAGAGGGAACCAGG + Intergenic
1146940732 17:36842786-36842808 ACAGGTGCACAGAGGGTCCCAGG - Intergenic
1148645637 17:49218345-49218367 ACAGCCACACAAAGGGGACTTGG + Intronic
1148794904 17:50192316-50192338 GGAGCAGCACAGAGGGAAGTGGG - Intronic
1150070279 17:62144369-62144391 TCTGCTGCAAAGAGGGGACTTGG - Intergenic
1151003532 17:70406119-70406141 ACAGCAACACAGAGGCAATTTGG + Intergenic
1151665927 17:75545132-75545154 TCAGCTGCACAGACAGAACTTGG - Intronic
1152176527 17:78791653-78791675 ACAGCTGCCCAGAGGCCTCTAGG + Intronic
1152183027 17:78836506-78836528 TCAGCTGCACAAAGGAAACAGGG + Intronic
1152279837 17:79378860-79378882 ACAGCCGCACAGTGGGTACAGGG + Intronic
1152498259 17:80690455-80690477 ACAGGTGCACAGAGAGTGCTGGG - Intronic
1152717154 17:81905626-81905648 AGAGGTGAACAGAGGGAACGAGG + Intronic
1153704196 18:7728489-7728511 ACATGTGCCCTGAGGGAACTGGG - Intronic
1154308887 18:13252609-13252631 GCAGCTGCACCCTGGGAACTCGG + Intronic
1156375874 18:36514956-36514978 CCAGCTGCATAGAGGGAGTTCGG + Intronic
1156522626 18:37734642-37734664 AAAGAAGAACAGAGGGAACTGGG - Intergenic
1159992276 18:74922805-74922827 ACAGCTGCACAGCAGGGACTAGG - Intronic
1160442412 18:78902671-78902693 ACAGATGCTCTGAGGTAACTCGG - Intergenic
1161402976 19:4077101-4077123 TCAGTTGCAGAGAGGGAACTGGG - Intergenic
1162262049 19:9541539-9541561 GCAGCTGCACAGGGTGTACTGGG - Intergenic
1162722011 19:12668214-12668236 CCAGCTGGATAGAGGGAACCTGG - Exonic
1162972337 19:14188240-14188262 ATAGCAGCGCAGAGGGAACCAGG - Intronic
1163273187 19:16266514-16266536 AAAGCTGCTCAGAGGGATGTGGG - Intergenic
1164502350 19:28830646-28830668 CCAGCAGCTCAGAGGGAATTTGG + Intergenic
1164854851 19:31512823-31512845 CCAGGTGCAGAGAGGGTACTGGG + Intergenic
1165025863 19:32960976-32960998 AGAACTGCACAGAGAGAACGAGG + Intronic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
1166372903 19:42312309-42312331 ATATCTGCATAGAGGGGACTGGG + Intergenic
1166641639 19:44499205-44499227 ACAGCAGCTCAATGGGAACTGGG + Intronic
1167373995 19:49101719-49101741 TCAGGGGCAAAGAGGGAACTGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925350782 2:3199664-3199686 ACATCTGGACAGAGGTAACAGGG + Intronic
926216730 2:10910293-10910315 CCAGCTCCACAGAGTGATCTCGG + Intergenic
927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG + Intronic
927271906 2:21220112-21220134 ACAGCTGGAGGGAGGGAAGTGGG - Intergenic
929526145 2:42704751-42704773 ACTGGTGCACTGAGGGAACATGG - Intronic
929758326 2:44786231-44786253 TCAGCTTCACAGAGTGATCTGGG + Intergenic
930145956 2:48004578-48004600 ATGCGTGCACAGAGGGAACTAGG + Intergenic
930343571 2:50149081-50149103 ACAGCAGCAGAGAGGGAAGGTGG + Intronic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
931430648 2:62206225-62206247 AGAGCTGCATGGAGGGAAATGGG - Intronic
934708042 2:96498307-96498329 CCAGCGGCACACAGGGCACTTGG + Exonic
935707885 2:105872204-105872226 GTAGCTGCAGAGAGGGATCTGGG - Intronic
937967904 2:127527841-127527863 ACAGCTGAAAAGAAGGAATTTGG - Intergenic
938403929 2:131016764-131016786 GCAGCAGCACTTAGGGAACTTGG - Intronic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
938955878 2:136297708-136297730 ACAGCTGCAAAGAGAGCACTAGG - Intergenic
939431465 2:142114612-142114634 ACAGCAACATAGATGGAACTGGG + Intronic
940293755 2:152101444-152101466 ACAGCAGCACTGAGTGTACTTGG + Intergenic
946436201 2:219657077-219657099 ACAGCTACAAAAAGGCAACTTGG + Intergenic
946861811 2:224007022-224007044 ACAACTGAACAGTGGCAACTAGG + Intronic
947588290 2:231370420-231370442 TGAGCTCCACAGAGGGAAGTGGG - Intronic
947823440 2:233088508-233088530 ACTGCTTCCCCGAGGGAACTAGG - Intronic
948455062 2:238101051-238101073 ACAGAAGCACTGTGGGAACTTGG + Intronic
948505664 2:238425864-238425886 ACAGCTGCACATCCCGAACTCGG - Intergenic
948509179 2:238451910-238451932 TCACCTGCTCTGAGGGAACTTGG + Exonic
1169099362 20:2932641-2932663 CCATCTGCTCAGAGGGAGCTTGG + Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1170392508 20:15890835-15890857 ACAGCTGCTAAGAGAGAATTAGG + Intronic
1170910822 20:20566120-20566142 GCAGCAGCACAGGGGGATCTGGG - Intronic
1171187459 20:23133060-23133082 GCAGCAGCACTGAGGGGACTGGG + Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171388624 20:24786817-24786839 AGAGCTGCTCAGAGAGCACTCGG + Intergenic
1171780572 20:29413591-29413613 ACAGATGGACAGAGGGACATTGG - Intergenic
1172491737 20:35344674-35344696 ACAGCTGCCCAGAGTGAGATCGG - Intronic
1174456940 20:50655474-50655496 ACAGCTGCACCGAGTGAATCTGG + Intronic
1175319791 20:58077383-58077405 ACAGCAGGACAGAAGGCACTTGG - Intergenic
1175962494 20:62644185-62644207 CCAGCAGCACAGAGGGAAGTCGG - Intronic
1178437916 21:32575773-32575795 ACAGCTGCATGGACAGAACTGGG + Intergenic
1178517752 21:33263184-33263206 ACAGCTCCACGGAGGGGTCTGGG + Exonic
1179034084 21:37745010-37745032 ACAGCAGAAGAGAGGGAACCAGG + Intronic
1179496713 21:41776483-41776505 ACACCTGCACTAAGGGAAGTGGG + Intergenic
1179500343 21:41804744-41804766 AGAGCTGAACAGAGGAGACTGGG - Intronic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1182393965 22:30021990-30022012 ACAGCTGAACAGAATGAACCTGG - Intronic
1183642187 22:39099521-39099543 GCAGCTGGAAAGAGGGATCTGGG + Intronic
1183831269 22:40419418-40419440 GCAGCTGGACACAGGGCACTGGG + Intronic
1183929419 22:41227583-41227605 AGGGCTGCTCAGAGGGACCTGGG - Intronic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
952556099 3:34532864-34532886 ACAGATGCAGAGATAGAACTGGG + Intergenic
953051373 3:39347399-39347421 GCAGCTGCAAAGAGGTACCTAGG + Intergenic
953793954 3:45968550-45968572 GCAGCTGGACAGAGAGAACCAGG - Exonic
954171372 3:48805396-48805418 AAAGCTGCACTGAGAGAACAGGG + Intronic
954520517 3:51221561-51221583 ACAGCTGCACTCAGAAAACTGGG - Intronic
954958559 3:54543833-54543855 ACAGATGCACAGAGGCATCTTGG - Intronic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
956253847 3:67263215-67263237 CCAGCAGCACAGAGGGAAGGGGG + Intergenic
956851104 3:73229055-73229077 ACAGATGCACAAAGGGACCCTGG + Intergenic
957084444 3:75667677-75667699 ACAGATGGACAGAGGGATATTGG + Intergenic
958188369 3:90152621-90152643 CCATCTGGACAGAGGGAATTTGG + Intergenic
958410893 3:93814455-93814477 CCATCTGGACAGAGGGAATTTGG + Intergenic
960173776 3:114493564-114493586 AGAGCTGCACAGAGAGAAAAAGG - Intronic
961010453 3:123432337-123432359 ACAGCTGCAAAGAGAGAAGTGGG + Intronic
961334322 3:126161104-126161126 ACAGAGCCACAGAGGGGACTGGG - Intronic
962965421 3:140349126-140349148 AGAGAAGTACAGAGGGAACTGGG - Intronic
963583340 3:147154234-147154256 GCAGCTGCAGAGGGGGCACTGGG + Intergenic
967673084 3:192262187-192262209 AAAGCTGCACGTGGGGAACTTGG - Intronic
968481292 4:834218-834240 ACAGCTGCACCCAGGGCACACGG - Intergenic
973880553 4:55267465-55267487 AATGCTGGACAGAGTGAACTAGG - Intergenic
973929972 4:55782202-55782224 ACAGATGGACAGATGGAAATTGG + Intergenic
974972967 4:68853819-68853841 CCAGCTGCAGAGAGGAAAGTCGG - Intergenic
975770183 4:77711937-77711959 TCAGCTCCACAGAGGGTCCTTGG + Intergenic
976358707 4:84151749-84151771 GCGTCTGCACAGAGGGAATTAGG - Intergenic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977379076 4:96247352-96247374 ACAGACACAAAGAGGGAACTTGG - Intergenic
977495390 4:97769059-97769081 AAAGCTGCAGAGAGGGAATGAGG + Intronic
980178016 4:129370679-129370701 AAATCAGCACAGAGGCAACTGGG - Intergenic
980427442 4:132644752-132644774 ACAGTAGCAGAGAGGGAGCTAGG - Intergenic
980651582 4:135723763-135723785 ACACGTGCACACAGGAAACTTGG - Intergenic
980881524 4:138715040-138715062 ACAGCTACTCAAAGGTAACTAGG - Intergenic
981718253 4:147773462-147773484 ACAGCTGCCCAGAGACAGCTTGG + Intronic
981829203 4:148980890-148980912 ACAGCTGAACAGTGTGGACTTGG + Intergenic
982729595 4:158941960-158941982 ACAGCTGCAAAGAGTGACTTTGG + Intronic
983365130 4:166776639-166776661 ACAGCTTAACAAAGGGATCTAGG + Intronic
985708940 5:1417463-1417485 ACAGGTGCACAGTGGCACCTGGG + Intronic
990132210 5:52599853-52599875 AGAGCTTCACAGAGGCAACACGG + Intergenic
995083710 5:108083836-108083858 ACAGCTGTATACAGGGACCTGGG + Intronic
998058728 5:139102371-139102393 ACATCTGCACAGTGGGATTTGGG + Intronic
999191368 5:149749947-149749969 ACAGATGGACAGATGGAGCTAGG + Intronic
999200489 5:149812865-149812887 TCAGCTTCCCAGAGGAAACTCGG + Intronic
999434966 5:151556361-151556383 GCAGCTGGACAGAGAGAACAAGG - Exonic
1001425052 5:171617472-171617494 GCAGCTGCTCAGAGGCATCTGGG + Intergenic
1001781730 5:174374618-174374640 ACAACTGTAGTGAGGGAACTGGG + Intergenic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1005812396 6:29527735-29527757 ACCACTGCACATAGGGGACTGGG - Intergenic
1010656080 6:78513564-78513586 ACTGCTGTACACAGGGAATTTGG + Intergenic
1010958321 6:82116925-82116947 AAACCTGCACAAAGGGAACAAGG + Intergenic
1011106732 6:83789991-83790013 AGAACTGCACACAGGGAACCAGG - Intergenic
1013942786 6:115685045-115685067 ACACATGAACACAGGGAACTTGG - Intergenic
1014677887 6:124390267-124390289 ACAGCAGCACTCAGGGAGCTTGG + Intronic
1017618009 6:156265616-156265638 ACAGCTGCATAGGGTGACCTGGG - Intergenic
1018565196 6:165144374-165144396 ACAGCCACATAGAGGGAACCTGG + Intergenic
1019276325 7:177855-177877 ACAGGAGCACAGAGGGAGCCTGG - Intergenic
1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG + Intergenic
1019338094 7:494551-494573 ACGGCTGTACAGAGGGGACGGGG + Intergenic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1019665365 7:2249556-2249578 ACTGGTACACAGAGGGCACTGGG + Intronic
1021002663 7:15352495-15352517 GCAGCTTTTCAGAGGGAACTGGG + Intronic
1023416060 7:39933905-39933927 AGAACTGCATAGAGAGAACTAGG - Intergenic
1024608194 7:51039919-51039941 ACAGTTGGACAGAGGGAGCAGGG + Intronic
1025147121 7:56514450-56514472 ATATATGCACTGAGGGAACTGGG - Intergenic
1025176819 7:56806295-56806317 ACGGCTGCATACAGGGAACCTGG + Intergenic
1025694974 7:63770091-63770113 ACGGCTGCATACAGGGAACCTGG - Intergenic
1027965346 7:84998764-84998786 ACAGGTTCACAGAGAGAAGTTGG - Exonic
1028387360 7:90271845-90271867 AAAGCTGTCCAGAGGGATCTGGG - Exonic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1029443421 7:100600529-100600551 ACAGGCACACAGAGGGACCTTGG - Exonic
1032509185 7:132458498-132458520 ACAGCTGCATAGAGTGAGCTGGG + Intronic
1033554798 7:142479554-142479576 ACAGCCTCACAGAGGGGAGTTGG - Intergenic
1037348432 8:17923610-17923632 AGAGTTCCACAGAGGGAACGCGG - Intronic
1037599474 8:20381781-20381803 ACAGCTGGCCAGAGGGGACAGGG - Intergenic
1037689733 8:21171906-21171928 CCCGCTGCACAGAGGGAGGTGGG - Intergenic
1038616717 8:29102356-29102378 ACAGTTACACAGAGGGAAGCTGG + Intronic
1039906609 8:41791016-41791038 ACAGCAGGACAGAGGGCACCAGG + Intronic
1039949918 8:42162300-42162322 ACAGCTGCCCAGTGGGAAGCTGG - Exonic
1041573541 8:59366387-59366409 TCAGCTGCTCAGGGGGCACTTGG + Intergenic
1045646612 8:104305603-104305625 ACACCTACACAGAGTCAACTTGG - Intergenic
1045853097 8:106727108-106727130 ACATCAGCACAGAGGGATTTAGG + Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1049520196 8:143084010-143084032 ACAGCTACACAGAGGCTTCTTGG - Intergenic
1050075296 9:1856563-1856585 ACAGGTGCTTAGAGGGAAGTAGG - Intergenic
1051848881 9:21485935-21485957 ATTGCTGCACAGAGGGAAATTGG - Intergenic
1055769394 9:79701215-79701237 TAAGCTGCACAGTGGGCACTGGG - Intronic
1057081748 9:92178760-92178782 AGAGCTGCAGAGGGGCAACTTGG + Intergenic
1057230107 9:93316921-93316943 ACAGGTGCATGGAGGGCACTCGG - Intronic
1057420820 9:94910764-94910786 ACATCTGCAGAGAAGGATCTTGG + Intronic
1060003506 9:119979773-119979795 ACAGCAGGGCAGAGGGGACTGGG - Intergenic
1060972021 9:127743763-127743785 ACTGAAGCACAGAGAGAACTGGG + Intronic
1062286493 9:135775260-135775282 ACAGCTGCACAGAGGTGGCTGGG - Intronic
1062333506 9:136054931-136054953 ACAGCTGCAGGGAGTGGACTCGG - Intronic
1062339342 9:136087064-136087086 ACAGATGCACAGAAGGAAGGTGG + Intronic
1062482990 9:136761042-136761064 ACAGATGCACAGAAGGAAGGTGG + Intronic
1186604806 X:11078766-11078788 ACAGATGCTAAGAGGGGACTGGG - Intergenic
1188340723 X:28998000-28998022 CCAGCTGCACTGAGGGAAAAGGG - Intronic
1188650623 X:32627267-32627289 CCAGATGCACAGAGGTAACATGG + Intronic
1189743440 X:44144912-44144934 ACTGCTGCTCAGAAGCAACTTGG - Intergenic
1195078112 X:101346677-101346699 ACAGAATCACAAAGGGAACTTGG + Intronic
1196192014 X:112804798-112804820 ACATCAGCACAGTGGAAACTAGG + Intronic
1198870691 X:141175335-141175357 ACAGCTGCACATAGGCAATAAGG + Intergenic
1199308274 X:146292879-146292901 ACAGATTCACAGAGGCCACTTGG - Intergenic