ID: 955077269

View in Genome Browser
Species Human (GRCh38)
Location 3:55625453-55625475
Sequence AAGAAGAGGGAGGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3957
Summary {0: 1, 1: 5, 2: 82, 3: 589, 4: 3280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955077269 Original CRISPR AAGAAGAGGGAGGAGGAGGC TGG Intronic
Too many off-targets to display for this crispr