ID: 955078131

View in Genome Browser
Species Human (GRCh38)
Location 3:55632988-55633010
Sequence ATAAATAGACAGGTGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955078131_955078139 26 Left 955078131 3:55632988-55633010 CCATTGTCCACCTGTCTATTTAT 0: 1
1: 0
2: 1
3: 24
4: 315
Right 955078139 3:55633037-55633059 CCTATTATCTCCTAGGCATAGGG 0: 1
1: 0
2: 0
3: 13
4: 130
955078131_955078137 25 Left 955078131 3:55632988-55633010 CCATTGTCCACCTGTCTATTTAT 0: 1
1: 0
2: 1
3: 24
4: 315
Right 955078137 3:55633036-55633058 GCCTATTATCTCCTAGGCATAGG 0: 1
1: 0
2: 1
3: 12
4: 145
955078131_955078136 19 Left 955078131 3:55632988-55633010 CCATTGTCCACCTGTCTATTTAT 0: 1
1: 0
2: 1
3: 24
4: 315
Right 955078136 3:55633030-55633052 CTTATTGCCTATTATCTCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955078131 Original CRISPR ATAAATAGACAGGTGGACAA TGG (reversed) Intronic
900715207 1:4139781-4139803 AAAGAGAGACAGGGGGACAAGGG + Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
902922000 1:19671787-19671809 ATAAATAGACATATGGAGAGGGG - Intronic
904637606 1:31895495-31895517 ATAAATAAAGAGGGGGGCAAAGG + Intergenic
906896677 1:49781011-49781033 ATAAGTAAATAGGTGGAAAAAGG + Intronic
907426792 1:54384858-54384880 AGAAATGGAAAGGTGGTCAATGG - Intronic
908424587 1:63994171-63994193 GGAAATAGATAAGTGGACAAAGG - Intronic
908863476 1:68518095-68518117 TTAATTAGCCAGGTGGAGAAAGG + Intergenic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
910086417 1:83408128-83408150 ATTCATAGATAGGTGGATAATGG - Intergenic
910607455 1:89102473-89102495 CTAAATTGAGAGGTGGAAAATGG + Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
910807216 1:91200761-91200783 AAAAATATACATGTCGACAATGG - Intergenic
910919681 1:92330198-92330220 GTACAAAGACAGGTGGAAAAGGG + Intronic
913125318 1:115781940-115781962 ATAAATAAAAAGGTGAAAAAAGG + Intergenic
914427830 1:147594893-147594915 ATAAAAAGAAAGGGGGAAAAAGG + Intronic
915177185 1:154025829-154025851 ATAATTACACACGTGGAGAATGG - Intronic
916045479 1:160997074-160997096 ATAAATAGACTGGTGGATGGTGG + Exonic
916254615 1:162773996-162774018 ATAAATAGAAATGTGAAAAAAGG - Intronic
916687080 1:167157276-167157298 ATAAAGTCACAGGTGAACAAAGG + Intergenic
916950476 1:169775288-169775310 ATAATTAGGCATGTGTACAAGGG + Intronic
917769476 1:178261433-178261455 ATAAAAACACAGGTGGAATATGG - Intronic
918539426 1:185612953-185612975 AAAAACAGACATGTAGACAATGG - Intergenic
918660889 1:187087452-187087474 AGAAATAAACTGGTAGACAAAGG + Intergenic
918778178 1:188665352-188665374 ATTAGTAGACAGGTGGAGGAAGG - Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
922083478 1:222322337-222322359 TTAAAAAGACAGGTGGACAGAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923411311 1:233712803-233712825 ATAAACAAAAAGGTGGAGAAAGG + Intergenic
923490894 1:234483156-234483178 AAAAAAAGTCAGGTGGAGAAGGG - Intergenic
924359761 1:243226519-243226541 ACACATAAACAGGTGGAAAAGGG + Intronic
924618774 1:245641348-245641370 ATAAATATTCAGGTACACAAAGG - Intronic
1063049182 10:2427215-2427237 CTAAAAAGAGAGGTTGACAAAGG - Intergenic
1063918490 10:10908543-10908565 ATAAATACACTGTTGGAGAAAGG + Intergenic
1065218361 10:23472217-23472239 AGAATTAGACATGTGGACACTGG - Intergenic
1067185853 10:44027114-44027136 AGAAATGGAAAGGTGGACCATGG + Intergenic
1068465896 10:57391120-57391142 CTAAATACATAGGTGAACAAAGG - Intergenic
1069341639 10:67416623-67416645 AAAAAAAAACAAGTGGACAAAGG + Intronic
1070214395 10:74362079-74362101 ATAAATATTCAGGTAGACTAAGG - Intronic
1070438954 10:76423760-76423782 AAAAATAGACACATGGGCAATGG - Intronic
1070638877 10:78151768-78151790 ATACATAGACTGGTGGAAAGTGG - Intergenic
1072183769 10:93014889-93014911 AAAAATAAAGAGGTGGAAAAAGG - Intronic
1072722048 10:97787160-97787182 AGAGATGGACAGATGGACAAAGG - Intergenic
1072730020 10:97839868-97839890 GTAAATAGACATGAGCACAAAGG - Intergenic
1075962860 10:126584441-126584463 ATAGACAGACAGGTAGACAGAGG - Intronic
1078596744 11:12693676-12693698 CAAAATAAACAGGAGGACAACGG - Intronic
1079493650 11:21016698-21016720 ATCAATATACAGGTGGGAAAGGG - Intronic
1080327310 11:31091518-31091540 ATGAATAGAGAGGGGGAGAAAGG + Intronic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083124153 11:60546360-60546382 ATAAATATCCAGGTGCAGAAAGG + Intergenic
1085821580 11:79799271-79799293 TAAAATAGACAGGTGGAAATGGG - Intergenic
1085918518 11:80922390-80922412 ATAAATAGATAGGTAGAAATAGG - Intergenic
1087427141 11:98004114-98004136 ATAAAAAGAGAGGTGGGGAATGG - Intergenic
1087972136 11:104497513-104497535 TTCAGTACACAGGTGGACAATGG - Intergenic
1088408165 11:109503755-109503777 AAAAATAGACAGGGGCACTATGG - Intergenic
1088752100 11:112852660-112852682 ATAAATAGCCATGTAGATAAAGG + Intergenic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1093989909 12:25578020-25578042 ACAACTAGGCAGGTGAACAAGGG - Intronic
1094271275 12:28619011-28619033 ATCAACAGACAAGTGGATAAAGG + Intergenic
1095040700 12:37437057-37437079 AAAAATAAAAAGGTGGACCATGG + Intergenic
1095122454 12:38435774-38435796 ATACATAGACAGATAGACATAGG - Intergenic
1095538567 12:43280995-43281017 AAAAATAGGCAGTTGGAAAAAGG - Intergenic
1096467535 12:51855697-51855719 ATAATTAGACGCGTGCACAAAGG - Intergenic
1096665762 12:53163080-53163102 AAAAATAGACAGGTGTATAGGGG + Intronic
1097235541 12:57537001-57537023 TTAAATAGACAGCCGGGCAATGG + Intronic
1097715626 12:62962890-62962912 ATAAAAAGACAAAAGGACAAAGG + Intergenic
1099895862 12:88645701-88645723 ATAATTAGGCAGGTAGATAATGG - Intergenic
1101799077 12:108004850-108004872 AGGAGTTGACAGGTGGACAAAGG - Intergenic
1101987281 12:109457482-109457504 ATAAGTAGACAGATGGATACAGG - Intronic
1103794895 12:123496603-123496625 ACAGATAGAAATGTGGACAATGG - Intronic
1104343802 12:127977495-127977517 AGACATAGAAAGGAGGACAAGGG + Intergenic
1104439542 12:128783571-128783593 ATAAATATACAGGTGGCTGAGGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107916798 13:45160302-45160324 ATAAATACATAGTTGGAAAAGGG + Intronic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1108445149 13:50501191-50501213 AGAAGAAGACAAGTGGACAAGGG - Intronic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1109980134 13:69896622-69896644 ATAAATAGAAAGATGAAAAAGGG + Intronic
1110481305 13:75980560-75980582 ATAAATAGACAATTGGATACTGG + Intergenic
1110517316 13:76429576-76429598 ACAAGTACACAGGTGGAGAAGGG + Intergenic
1110868830 13:80426365-80426387 ATGAATAAAGAGGTGGACAGAGG - Intergenic
1111504247 13:89165581-89165603 ATAAATAGAGAGGTGAAAATGGG - Intergenic
1111585108 13:90273437-90273459 ATTATGAGACAGGTGGACAATGG - Intergenic
1112666486 13:101580749-101580771 AAAAAGAGAGAGGTGGAAAATGG + Intronic
1113684811 13:112275647-112275669 ATAGATAGATAGATGGAAAAAGG + Intergenic
1114957405 14:27840993-27841015 ATAAAAAGACAGATGGATTAAGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1116626203 14:47267140-47267162 ATAGATACAAAGGTGGAAAAGGG + Intronic
1119366625 14:74097906-74097928 AAAAATAGAGAGGTGGTCTATGG - Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120808369 14:88776992-88777014 ATAAAGAGACAGGAGTAGAAAGG + Intronic
1121181108 14:91929742-91929764 AAAAATAGACAGATGAACTAGGG + Intronic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1125253947 15:37740954-37740976 ATAAGTACACAGGCTGACAAGGG - Intergenic
1125959696 15:43819237-43819259 ATAGATAGATAGATGAACAATGG + Intronic
1125965661 15:43873843-43873865 AAAACTAGCCAGGTGGACCAAGG - Exonic
1127364769 15:58278076-58278098 ATAAATAAATATGTAGACAATGG + Intronic
1127667151 15:61159042-61159064 ATAAATATACAGCTAGACATAGG + Intronic
1128025981 15:64437097-64437119 ATAAATAGAGAGGGAGACAATGG + Intronic
1128608706 15:69057226-69057248 ATAAATTGACAGATGGAAAGAGG - Intronic
1128899674 15:71408984-71409006 ATAAATAAACCTGAGGACAAGGG - Intronic
1130776799 15:86992626-86992648 ATAAATGGACAGATGGCCATGGG + Intronic
1131626856 15:94129506-94129528 ATAAATTAACAGGTGGGTAAAGG - Intergenic
1131916518 15:97271602-97271624 ATAAATAAACAGGTGGGCCAGGG - Intergenic
1132123938 15:99203570-99203592 ATAAAAATACAGGTGAATAATGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137369837 16:47895118-47895140 ATAGGTAAATAGGTGGACAAGGG - Intergenic
1137587742 16:49674096-49674118 AAAAATAGGCAGGTGGAAAACGG + Intronic
1137767923 16:50992026-50992048 AAAATTAGGCAGTTGGACAAAGG - Intergenic
1138067141 16:53954159-53954181 ATAAAAAGACAAGGGGAAAAGGG + Intronic
1138869323 16:60862508-60862530 ATTGCTAGACAGGTGGACAGGGG - Intergenic
1139283462 16:65789587-65789609 ATAACTAGATAGTTGGAAAAGGG + Intergenic
1139465715 16:67153020-67153042 ATGAATAGACAGGTGGGGAGTGG - Intergenic
1140403455 16:74691064-74691086 TTAAATATATATGTGGACAAAGG + Intronic
1140413607 16:74757172-74757194 ATCAATAGAAAGATGGATAAAGG + Intronic
1140699082 16:77564658-77564680 AGAAATAGACAGGAAGAGAATGG + Intergenic
1140999351 16:80293921-80293943 GTAGATAGACAGATGGACATGGG + Intergenic
1141258112 16:82422512-82422534 ATATGTAGACAGATGGATAATGG + Intergenic
1141271812 16:82547699-82547721 ATAGATAGAAAGGTAGACAGAGG - Intergenic
1143167366 17:4903577-4903599 ATAAAGAGACAGGTGGTCACAGG + Intergenic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145195334 17:20888961-20888983 ATAAAGAGACAGGGAAACAAAGG - Intronic
1145377139 17:22361310-22361332 AAAAATAAAAAGGTGGACCATGG - Intergenic
1146257882 17:31402125-31402147 ATAAACAGATGGGTGGACTAAGG - Intronic
1146593915 17:34153489-34153511 AAAAAAAGACAGAGGGACAAAGG + Intronic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1149951418 17:60991313-60991335 ATAAATAAACAGAAGTACAATGG - Intronic
1150186395 17:63186249-63186271 ATAGATAAAAAGGTGGTCAATGG - Intronic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1152169950 17:78739115-78739137 AGCAATAGAAAGGTGGGCAAAGG - Intronic
1152473668 17:80503934-80503956 ATGAATAGATGGGTGGATAAGGG + Intergenic
1153179701 18:2419176-2419198 CTAAATAGAGAGGAGGAAAAAGG + Intergenic
1153746326 18:8183766-8183788 AAAAATAAACAGGTAGACAAAGG + Intronic
1155948326 18:31881284-31881306 AAAAATAGACACATGAACAATGG + Intronic
1156564241 18:38165607-38165629 ATAAACAAAAAGGTGGAGAAAGG - Intergenic
1156566027 18:38191955-38191977 ATAAATAGACACTGGGAAAAGGG + Intergenic
1156748001 18:40415956-40415978 TTCAATAGACAGGAGAACAAAGG - Intergenic
1156975594 18:43218385-43218407 ATCAATATACATGTGAACAAAGG - Intergenic
1157940909 18:51928274-51928296 ATAAGAAGAAAGGTGGAGAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1159837001 18:73349828-73349850 AGAAATAGACCAGTGTACAAAGG - Intergenic
1160281143 18:77492313-77492335 AAAAAAAGACAGGGGGAAAAAGG + Intergenic
1161439775 19:4284414-4284436 ATCTACAGACAGGTGGACAAAGG - Intronic
1164670306 19:30068594-30068616 ATTAATAGATAGGTGAATAAAGG - Intergenic
1165547998 19:36557894-36557916 ATACATATTCAGGTAGACAAAGG + Intronic
1165710035 19:38004479-38004501 ATAAAGAGACAGAAGGAAAATGG - Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1168273496 19:55263180-55263202 ATAAATAGATAAGTGGGCAAAGG + Intronic
1168319851 19:55502489-55502511 ACAAAAAGACAGAAGGACAAGGG - Intronic
1168671532 19:58244503-58244525 ATAAAGACACAGTCGGACAACGG - Intronic
925510987 2:4625335-4625357 ATAGATAGGTAGGTAGACAATGG + Intergenic
925752244 2:7099181-7099203 ATAATAAGAAACGTGGACAAAGG - Intergenic
928710221 2:33996672-33996694 ATAAATATCCAGGTAGAGAAAGG - Intergenic
928732172 2:34244176-34244198 TTAAAAAGTCAGCTGGACAAGGG + Intergenic
928985343 2:37175389-37175411 ATAAATAGAAATTTAGACAATGG - Intronic
929562892 2:42966805-42966827 AAAAATAGAAATGTGGAGAATGG + Intergenic
932184226 2:69678235-69678257 ATAATTTGAAAGGTAGACAAAGG - Intronic
933132813 2:78694013-78694035 TAAAATAGACACGTGGATAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934162300 2:89261534-89261556 AAAAATTAAAAGGTGGACAAAGG + Intergenic
934479878 2:94626861-94626883 ATAAAAAGACAGATGGATTAAGG - Intergenic
935848600 2:107194581-107194603 ATAGATAGACAGATGTACCAAGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936653874 2:114461871-114461893 AAAAAGAGACAGGTGGAGAGAGG + Intronic
937556277 2:123161343-123161365 TTTAATAGCCAGGTTGACAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938777927 2:134558507-134558529 ATAGAAAGACAGCTGGAAAATGG + Intronic
939841383 2:147192525-147192547 ATAAATAGAAATGATGACAATGG - Intergenic
940031371 2:149265472-149265494 ATAAAGAGGCACGTGGACATGGG - Intergenic
940739372 2:157489744-157489766 ATAAAAAGACCCGTGGATAAAGG - Intergenic
943587246 2:189756033-189756055 ATAAAGGGACAGGGGGACTAAGG + Intronic
943904414 2:193479740-193479762 ATAAATAGAAAAGAAGACAAAGG + Intergenic
944293666 2:198036970-198036992 TTAAATCAACAGGTGGACACTGG + Intronic
945634754 2:212333711-212333733 GTAGATATACAGGTGGACCAAGG - Intronic
945789614 2:214288742-214288764 ATAAATAAATAAGTGGGCAAAGG - Intronic
946191764 2:218011307-218011329 ACACAGAGACAGGTAGACAAAGG + Intergenic
948727203 2:239942118-239942140 ATTTATAGGAAGGTGGACAAAGG - Intronic
949075673 2:242055876-242055898 ATAAACAGACATGGGGACAGAGG - Intergenic
1169170992 20:3465076-3465098 AAAAGTAGAAAGATGGACAAAGG + Intergenic
1169790398 20:9404031-9404053 AGAAATGGACTGGTGGCCAAGGG + Intronic
1170315585 20:15037831-15037853 ACAATTAGACAGGAGGACTAAGG + Intronic
1170318542 20:15068916-15068938 AGAAAAAGACAGGAAGACAAGGG + Intronic
1170531822 20:17300606-17300628 AGAAGTAGAAAGGTGGTCAAGGG + Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170713501 20:18812662-18812684 AGAAATAAACAGGTGGACTTTGG + Intronic
1171274476 20:23844304-23844326 ATAAATAGACAGATGAGAAAAGG - Intergenic
1171526345 20:25814587-25814609 AAAAATAAAAAGGTGGACCATGG + Intronic
1171550482 20:26041298-26041320 AAAAATAAAAAGGTGGACCATGG - Intergenic
1171805799 20:29679221-29679243 AAAAATAAAAAGGTGGACCATGG - Intergenic
1171838262 20:30177214-30177236 AAAAATAAAAAGGTGGACCATGG + Intergenic
1172391973 20:34571690-34571712 AGAAAAAGACAGTGGGACAAGGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178291878 21:31375483-31375505 AAAAACAGAAAGGTGGACGAAGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178967066 21:37130853-37130875 ATACATGAACAGGTGCACAAAGG - Intronic
1180903729 22:19393736-19393758 ATAAACAGATTGGTGGACTAAGG - Intronic
1184311678 22:43649221-43649243 ATAAATTGACAAGAGGGCAAAGG + Intronic
1184327537 22:43800963-43800985 ATAAATATCCAGGTACACAAAGG + Intronic
1184979861 22:48088332-48088354 ATAGATATCCAGGTGGAAAATGG - Intergenic
949879946 3:8653374-8653396 GTAAATTGACATGTGGACATTGG - Intronic
950611747 3:14131464-14131486 AGAAATAGAGAAGGGGACAAGGG - Intronic
952288941 3:31996488-31996510 ATAAATTGCCAGGGGGAGAAGGG + Intronic
952876501 3:37949118-37949140 ATAAGTAGAAAGCTGGAAAATGG - Intronic
953079701 3:39604612-39604634 ATAAATACAAAAGTTGACAAAGG - Intergenic
953400939 3:42616243-42616265 ATAAATAAAAAGGTTTACAATGG + Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
957368467 3:79258144-79258166 AAAATTAGACATGTGGAGAAAGG - Intronic
957417174 3:79920188-79920210 AAAAATACAGAGCTGGACAATGG - Intergenic
958545145 3:95538303-95538325 ATAAATAGAAAAGTGGATAATGG + Intergenic
960981428 3:123231186-123231208 AGAAATAGACAATTGAACAATGG + Intronic
961183918 3:124898179-124898201 ACAAATAGATATTTGGACAATGG - Intronic
962746030 3:138397958-138397980 ATAATTTGACAGGTGAAAAATGG - Intronic
963281216 3:143386253-143386275 ATAAACAGACAGGTGAGCAAAGG - Intronic
963594865 3:147313623-147313645 TTAAATAGACAGCTGCATAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
968250591 3:197207778-197207800 ATAAATAGCAAGGGGGAAAATGG + Intronic
969884805 4:10205952-10205974 ACAAAGAGTCAGGTGGACAAGGG - Intergenic
971531972 4:27700417-27700439 AAAAAGAGACAGGAGGAGAATGG + Intergenic
972011957 4:34194200-34194222 ATACATTGACAGCTAGACAATGG + Intergenic
972801159 4:42477103-42477125 AGAAATAGAGCGGTGAACAATGG - Intronic
974590302 4:63940007-63940029 ATAAACAGAGAGATGAACAAAGG - Intergenic
974734570 4:65912872-65912894 AGAAAAAGACAAGAGGACAAGGG - Intergenic
975475043 4:74813630-74813652 AGAAAGAGACAGGTAGAGAAAGG + Intergenic
977765102 4:100788116-100788138 ATAAGTAAACAGGTCCACAAAGG - Intronic
978417362 4:108490714-108490736 ATAGATAGATAGGTAGATAATGG + Intergenic
978449106 4:108810319-108810341 ATAGATAGATAGTTAGACAAAGG + Intergenic
979114864 4:116810702-116810724 ATAAATATACAGCTGCATAAGGG + Intergenic
979785096 4:124707255-124707277 ATAATTCAACAGGTGGAAAATGG - Intronic
980420619 4:132555319-132555341 ATAGATAGACAGATAGATAATGG - Intergenic
981589633 4:146345461-146345483 ATAGAGAGCCAGGTGGAGAATGG - Intronic
984757003 4:183333613-183333635 TTAAATACACAGGATGACAAAGG + Intergenic
984864573 4:184270699-184270721 ATAGATAGACAGGTGGATAGAGG - Intergenic
985181314 4:187266841-187266863 AGATATAGACAGGGGAACAATGG - Intergenic
985930317 5:3051901-3051923 ATAAAAAGAAAGGGGGAGAAGGG + Intergenic
987062411 5:14254940-14254962 ATAAATAGAAAGGGAAACAATGG + Intronic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
990358285 5:54992716-54992738 ATAGATAGACAGACAGACAATGG + Intronic
990929373 5:61071217-61071239 ATAAATTTACAGTAGGACAAGGG - Intronic
991280976 5:64912295-64912317 AAAAATAGCCAGGTGCACAAAGG + Intronic
992777543 5:80101837-80101859 ATAAATAGAGAGATAGAAAATGG + Intergenic
993958888 5:94271923-94271945 ATCAACAGACAAGTGGATAAAGG + Intronic
995151103 5:108846558-108846580 ATAAATAAAAAGGTGAATAAAGG - Intronic
995487865 5:112657376-112657398 ATAAATAGAGAAGTGAGCAATGG + Intergenic
995684136 5:114752627-114752649 ATAAACAGAAAAGTGGAAAAAGG - Intergenic
995755671 5:115501403-115501425 ATAAATAGATATGAGGAGAAAGG - Intergenic
996066994 5:119090368-119090390 ATAAATATCCAGGTAGACAAAGG - Intronic
997228327 5:132226231-132226253 ATAAATTCTTAGGTGGACAATGG + Intronic
997244495 5:132335555-132335577 AACAAAAGACAAGTGGACAAAGG + Intronic
998651222 5:144123808-144123830 ATAAATATACAGGATTACAAAGG - Intergenic
999267145 5:150274112-150274134 CTAAAGAGACAGGTGGAAAATGG + Intronic
1001261141 5:170230045-170230067 ATGAACAGACAGGAGGAAAATGG + Intergenic
1002078609 5:176724560-176724582 AAAAATAGAAAGGAGGAGAAGGG - Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1004157865 6:13186242-13186264 ATAGACAGACAGATGGACAGTGG - Intronic
1006197426 6:32254613-32254635 ATAAATAATCAGGCAGACAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010412392 6:75575214-75575236 AAAAAAAAAAAGGTGGACAAAGG + Intergenic
1011647229 6:89471475-89471497 ATATATAGACAGGAGGCCCAAGG + Intronic
1012245513 6:96922134-96922156 ATAAAAAGAAAAGTGGACACTGG - Intergenic
1012252598 6:96995565-96995587 ATAAACAGACAAGGGAACAAAGG - Intronic
1012727403 6:102831904-102831926 GTAAATATAGAGGTTGACAAGGG + Intergenic
1013813025 6:114065936-114065958 AAAAACAGACAGGTGGACCAAGG - Intronic
1014674750 6:124349675-124349697 ATAATTAGAAAGGTAGACCAAGG - Intronic
1015585267 6:134769959-134769981 AGACATAGGCAGGTGTACAAGGG - Intergenic
1015611142 6:135020792-135020814 ATAACCAGACAGCTAGACAATGG + Intronic
1016127961 6:140429178-140429200 ATAAATAGACACGTAGATAATGG - Intergenic
1016591308 6:145746769-145746791 ATAAATAGCTAGGTAGATAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018021922 6:159769339-159769361 ATAAAAACACAGGCAGACAATGG + Intronic
1018326649 6:162677278-162677300 ATAAAAAGACAGACGGGCAAGGG + Intronic
1019503640 7:1378974-1378996 ATAGATAGATAGGTGGATGAAGG + Intergenic
1021103620 7:16612007-16612029 AGAATTAGACAGGTGGACACTGG - Intronic
1021946767 7:25735392-25735414 ATAAAAAGAAAGGTGGAAATGGG - Intergenic
1024028171 7:45432139-45432161 GAAAATAGAAAGTTGGACAAAGG + Intergenic
1025286755 7:57668693-57668715 AAAAATAAAAAGGTGGACCATGG + Intergenic
1027303299 7:76864605-76864627 ATTCATAGATAGGTGGATAATGG - Intergenic
1028665615 7:93340568-93340590 ATAAACAAACAGGTTGGCAAAGG - Intronic
1030419935 7:109296210-109296232 ATGAATAGACAGTTGACCAAGGG + Intergenic
1030542932 7:110855633-110855655 ATAAATTGACAGATGGCTAAGGG - Intronic
1030550893 7:110958346-110958368 ATAAACACACAGGTGTACAAAGG + Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031161198 7:118170694-118170716 ATAAGTAGAGTGATGGACAAAGG - Intergenic
1031217653 7:118917085-118917107 ATAAATATCCAGGGGTACAATGG - Intergenic
1031329845 7:120451034-120451056 ATCAATAGACAGAAGGAAAAAGG - Intronic
1032766025 7:134994707-134994729 ATAGATAGACATGGGGAGAAAGG + Intronic
1032982118 7:137296390-137296412 ATAAATAGAAAGGTTGACAAAGG + Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1037921273 8:22807907-22807929 ATGAATGGATAGGTGGACAGAGG - Intronic
1038778034 8:30548653-30548675 ATAAATACAGAAGTGGACCATGG + Intronic
1038846793 8:31237539-31237561 AAAAAAAGAAAGATGGACAAAGG - Intergenic
1040717789 8:50279259-50279281 ATCAATAAACATGTGGAAAATGG + Intronic
1041225582 8:55694234-55694256 AAAATTAGAAAGGTGGAGAATGG - Intergenic
1043774286 8:84245321-84245343 ATAAAATGAAAGGAGGACAATGG + Intronic
1044507215 8:93036004-93036026 ACAAATAGATAGATGGAAAATGG + Intergenic
1047120723 8:121901623-121901645 ATATATAGAGAAGTAGACAATGG - Intergenic
1047744152 8:127831566-127831588 ATAGATAGAAAAGTGGACATAGG + Intergenic
1048157460 8:131972078-131972100 ATACATAGAAAGGTAGAAAAGGG - Intronic
1048601391 8:135922382-135922404 ATAAATGGATAGGTGGAGATTGG - Intergenic
1048708206 8:137178375-137178397 ATAGACAGACAGCTGCACAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1052763034 9:32611944-32611966 ATAAATAGACATATGGAATATGG - Intergenic
1053677957 9:40456743-40456765 ATAAAAAGACAGATGGATTAAGG + Intergenic
1053794266 9:41710689-41710711 AAAAATAAAAAGGTGGACCATGG + Intergenic
1053927878 9:43084769-43084791 ATAAAAAGACAGATGGATTAAGG + Intergenic
1054182674 9:61922733-61922755 AAAAATAAAAAGGTGGACCATGG + Intergenic
1054285772 9:63168212-63168234 ATAAAAAGACAGATGGATTAAGG - Intergenic
1054291030 9:63292269-63292291 ATAAAAAGACAGATGGATTAAGG + Intergenic
1054389051 9:64596816-64596838 ATAAAAAGACAGATGGATTAAGG + Intergenic
1054470684 9:65535245-65535267 AAAAATAAAAAGGTGGACCATGG - Intergenic
1054506667 9:65919555-65919577 ATAAAAAGACAGATGGATTAAGG - Intergenic
1054655833 9:67665746-67665768 AAAAATAAAAAGGTGGACCATGG - Intergenic
1054904748 9:70404873-70404895 ATAAATAGAATGGTGGAGACAGG + Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058765940 9:108182843-108182865 ACAAATTGAAAGGTAGACAAAGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059794196 9:117673636-117673658 ATAAAAAGAAATGTGGAAAAAGG - Intergenic
1062018440 9:134304176-134304198 CTAAATAGACAGCAGGGCAAAGG + Intergenic
1185544132 X:928315-928337 ATACATAGACAGATAGATAATGG - Intergenic
1187492297 X:19763423-19763445 AGAAAAAGACAAGTGGATAACGG - Intronic
1188103989 X:26125842-26125864 ATAAATAGATAGATAGATAATGG - Intergenic
1190959039 X:55227355-55227377 AGAAGAAGACAGGAGGACAAGGG + Intronic
1191007227 X:55722515-55722537 ATAAACAAAAAGTTGGACAAGGG - Intronic
1191604675 X:63047982-63048004 TCAAATAAACAGGTGGAGAAAGG - Intergenic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1194579061 X:95648886-95648908 ATAAATACAGAGGTGAAGAATGG + Intergenic
1195283334 X:103358069-103358091 ATAAGTAGAAATATGGACAAAGG - Exonic
1195318201 X:103699285-103699307 ATAAATAGACAGTTTTAGAAAGG + Intergenic
1198709648 X:139487456-139487478 ATAAATGGACAGGAGGATAAGGG + Intergenic
1198948188 X:142039202-142039224 ATAAAATGACAAGTGGACAGGGG + Intergenic
1199800078 X:151241718-151241740 CTCAATAGAAATGTGGACAAAGG + Intergenic
1199938567 X:152601751-152601773 ATAAATAGAGAGATGTCCAAAGG + Intergenic