ID: 955078960

View in Genome Browser
Species Human (GRCh38)
Location 3:55640145-55640167
Sequence AGAAAATCAAGGCAAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 502}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955078960_955078964 -9 Left 955078960 3:55640145-55640167 CCACACCCTTGCCTTGATTTTCT 0: 1
1: 0
2: 1
3: 44
4: 502
Right 955078964 3:55640159-55640181 TGATTTTCTGTCATCCTCTTTGG 0: 1
1: 0
2: 0
3: 43
4: 562
955078960_955078965 3 Left 955078960 3:55640145-55640167 CCACACCCTTGCCTTGATTTTCT 0: 1
1: 0
2: 1
3: 44
4: 502
Right 955078965 3:55640171-55640193 ATCCTCTTTGGTAACTAACTTGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955078960 Original CRISPR AGAAAATCAAGGCAAGGGTG TGG (reversed) Intronic
900089951 1:915869-915891 ACAAATTCAAGGCAAGGTTCTGG + Intergenic
901315996 1:8308812-8308834 AGAAAATCAAGGGAGGGAAGGGG + Intergenic
902978903 1:20109280-20109302 AACAAAGCAAGGCAAGGATGTGG + Intergenic
903293949 1:22331982-22332004 ATAAACTCCAGGCAGGGGTGGGG + Intergenic
903490433 1:23724075-23724097 AAAAAATAAAGGGATGGGTGGGG + Intergenic
903542071 1:24102154-24102176 AGACAAACATGGCATGGGTGAGG - Intronic
904785710 1:32981166-32981188 AGAAAATTAAGGCCAGAGAGGGG + Intergenic
904867721 1:33594729-33594751 AGAAAAACAATGCAAAGATGAGG - Intronic
907444336 1:54498425-54498447 AGAAAATTAAGTCAATGGGGAGG + Intergenic
907469345 1:54662830-54662852 AGAAAGTCAAAGAAAGGCTGAGG - Intronic
907941386 1:59091196-59091218 ATAAAGTTGAGGCAAGGGTGGGG + Intergenic
907978319 1:59455444-59455466 AGAATGAGAAGGCAAGGGTGGGG + Intronic
908189996 1:61692558-61692580 AGAAAGTCATGGCAAGAATGGGG + Intronic
908928952 1:69292804-69292826 AGAAAATCAAGGATAGTGAGAGG - Intergenic
909246651 1:73294009-73294031 AGACAGTCAAGGCTAGGATGAGG + Intergenic
909549889 1:76886030-76886052 GGAAAATAAAGGCAAACGTGAGG - Intronic
909828541 1:80156171-80156193 AGAAAATTAAGGTGAGGCTGGGG + Intergenic
909843144 1:80355773-80355795 AAAAAAGCAATGCAAGGCTGAGG + Intergenic
909921698 1:81389069-81389091 ACAAAATCAATGAAAAGGTGGGG - Intronic
910226294 1:84939547-84939569 TGGAAATCAAAGCAAAGGTGAGG - Exonic
911147343 1:94565477-94565499 GCAAAATCAGGGCATGGGTGGGG - Intergenic
911174217 1:94803176-94803198 AGAAAAGCAAAGCAAGGTTGAGG + Intergenic
911372047 1:97005410-97005432 AAAAAATCAAGGCAAAAGGGGGG - Intergenic
911743463 1:101412877-101412899 ATAAAATTAAGGCAAAGGGGTGG + Intergenic
912285529 1:108364773-108364795 AGAACCACAAGGCAAGGGTTTGG + Intergenic
913024347 1:114821195-114821217 AGGAAAAAAAGGCAAAGGTGTGG - Intergenic
913675299 1:121134970-121134992 AGAGAATCAAGGCAGGGGCTTGG - Intergenic
914027136 1:143922589-143922611 AGAGAATCAAGGCAGGGGCTTGG - Intergenic
914453443 1:147813492-147813514 AGTAAATCAAGGAAAGGGACTGG - Intergenic
915101108 1:153500922-153500944 AGAAAGCAAAGGAAAGGGTGAGG - Intergenic
915146336 1:153797869-153797891 AGAAACTCAAAGCGAGGGTGGGG + Intergenic
916345201 1:163781609-163781631 ACAAAATCCTGGCAAGGATGTGG + Intergenic
916737883 1:167624021-167624043 GGAAAGTCAAGGAAAGGCTGAGG - Intergenic
917640679 1:176980514-176980536 AGAAAACCAATGCAAGGCTGAGG + Intronic
919458297 1:197846191-197846213 AGGAAAGGAAGGCAAGGGAGGGG - Intergenic
919792322 1:201300172-201300194 AGAAAATGGAGGCAAGTGAGCGG + Intronic
920462661 1:206153807-206153829 AGAGAATCAAGGCAGGGGCTTGG - Intergenic
921066130 1:211623164-211623186 AGAAACTCCAGGCAAAAGTGAGG + Intergenic
921183942 1:212654318-212654340 AGAAAATCTGGGCAAGGGGAAGG + Intergenic
921316778 1:213899307-213899329 AGAACAACAAGGAAAGGGTTAGG - Intergenic
921490600 1:215771141-215771163 AGAAAGAAAAGGAAAGGGTGAGG + Intronic
921779699 1:219147727-219147749 AGAGAACTAAGGCATGGGTGAGG - Intergenic
922347204 1:224706204-224706226 AGAATATTAGGGCTAGGGTGGGG + Intronic
923219929 1:231883697-231883719 AGAAATTCAAGGTAAGGATGAGG + Intronic
923356744 1:233163702-233163724 AGAAAGTCAAGGCTATAGTGAGG - Intronic
924026515 1:239838965-239838987 AGAAAATTAAAGCATGGATGGGG + Intronic
1063270287 10:4501381-4501403 AGAAAATCAAGGAAAGTATGAGG + Intergenic
1063272968 10:4532206-4532228 AGAAAATCAAGCCAAAAGTGTGG - Intergenic
1063892416 10:10644050-10644072 AGAAAACAAAGGCAAGGCTTGGG - Intergenic
1064404224 10:15046810-15046832 AGAAAATTAGGGTAAGGGTGAGG - Intronic
1065384259 10:25118007-25118029 AAAAAAGCAAGGCAAGTGTGTGG - Intergenic
1065692533 10:28350188-28350210 AGAAAATGAAGAAAAGGGGGAGG + Intergenic
1067509939 10:46886188-46886210 GGAAAAACCAAGCAAGGGTGGGG + Intergenic
1067652314 10:48165670-48165692 GGAAAAACCAAGCAAGGGTGGGG - Intronic
1067725868 10:48770549-48770571 AGATATTCAAGGCAAGAGGGTGG + Intronic
1068850286 10:61730925-61730947 AGAAAAATAAGGAAAGGCTGAGG + Intronic
1069795016 10:71046422-71046444 AGAAAAACTAGGCAAAGATGAGG - Intergenic
1070215955 10:74380899-74380921 AGAAAAACAGGGTGAGGGTGCGG - Intronic
1070514362 10:77190007-77190029 AAATAATGAAGGCAAGGGTTTGG - Intronic
1071050054 10:81436353-81436375 GGAAAAACAAGGAAAGGCTGAGG + Intergenic
1073678493 10:105676971-105676993 AACAAATCATGGCAAGGTTGTGG - Intergenic
1075120390 10:119660218-119660240 AGAAAAGCCAGGCCAGGCTGGGG - Intronic
1075277074 10:121103799-121103821 AGAAAATCAATGCATGTTTGTGG + Intergenic
1076550788 10:131277085-131277107 ACAGAATCAAGGCATTGGTGGGG + Intronic
1076590872 10:131581253-131581275 AAACAGGCAAGGCAAGGGTGTGG - Intergenic
1079077432 11:17392928-17392950 AGAAAACCCAGGCAGGGGTATGG + Exonic
1079471561 11:20783037-20783059 AGAAATTCCAGGCACGGGTGTGG + Intronic
1079511416 11:21215593-21215615 AGAAAATGAAGTCCAGGTTGAGG + Intronic
1079709969 11:23669830-23669852 TTAAAGTCAAGGCAAGGATGAGG - Intergenic
1080501320 11:32874212-32874234 AGAAGAGCAAACCAAGGGTGTGG + Intergenic
1081046922 11:38286284-38286306 AGAAAATAAAGGAAAGGATTAGG + Intergenic
1082831621 11:57622728-57622750 TGAAAATAAAGGCTAGAGTGGGG - Intergenic
1082891031 11:58139018-58139040 AGAAAGACAAAGCAGGGGTGGGG + Intronic
1083199086 11:61108975-61108997 GGGAAATGGAGGCAAGGGTGTGG - Intronic
1083314965 11:61809022-61809044 AGAAAGCCATGGTAAGGGTGTGG - Intronic
1085397677 11:76215140-76215162 AGATCTTCCAGGCAAGGGTGGGG + Intergenic
1085654793 11:78303972-78303994 TGAAAATCAGGGCAAAGTTGGGG + Intronic
1085907315 11:80779336-80779358 AGAAAAATAAGGTAAGGGTGGGG + Intergenic
1086986293 11:93252872-93252894 AGAAAATGCTGGCAAGGATGTGG + Intergenic
1087122749 11:94591885-94591907 AGAAAATTGGGGCAAGGGAGAGG + Intronic
1087349684 11:97015754-97015776 AGAAAAGCAAGGAAAGGAAGGGG + Intergenic
1088254140 11:107887103-107887125 TAAAAATCAAGGTATGGGTGAGG - Intronic
1089680828 11:120118043-120118065 TGAAAATGAGGGCAGGGGTGGGG - Intronic
1090183738 11:124722507-124722529 AGACAAAAAAGGAAAGGGTGAGG + Intergenic
1090691729 11:129190214-129190236 GGAAAATGGAGGCATGGGTGTGG - Intronic
1090761306 11:129839045-129839067 AGAAAATGGAGGCAAGAGTAAGG - Intronic
1090914556 11:131151814-131151836 AGAAGATGAAGGCAAGAGGGGGG + Intergenic
1091034784 11:132223266-132223288 AGAAAATCAACACATGGCTGAGG + Intronic
1091667573 12:2430512-2430534 GCAAACTCAAGGCAAGTGTGAGG - Intronic
1092126099 12:6075946-6075968 AGAAGATCAAGGTCAGGGAGGGG - Intronic
1092355778 12:7794038-7794060 AGAAAATAAAGGCAAGGGCCGGG - Intronic
1093186007 12:16020709-16020731 AGACAATGAAGTCAAGGCTGAGG + Intronic
1093917998 12:24827499-24827521 CCACAATCAAGGCCAGGGTGCGG + Intronic
1094836009 12:34322407-34322429 GGAAAAACAAGGCAAGGCAGAGG - Intergenic
1095145949 12:38726171-38726193 AGAAAATGAAGGCAACAGTTAGG + Intronic
1095590518 12:43897906-43897928 AGAAAATGAAGGCAAAGGCCAGG - Intronic
1095677935 12:44941015-44941037 AAAAAATAAAGTCAAGGGAGGGG - Intergenic
1096828450 12:54296865-54296887 AGAAGATAAAGACACGGGTGAGG - Intronic
1097021221 12:56021917-56021939 AGAAAATCAAGGTAAGGAAGAGG + Intronic
1097157493 12:57023503-57023525 AAAAAATCAAGGCCGGGGAGGGG - Intronic
1097276536 12:57817434-57817456 ACTAAAGCAAGGCAATGGTGCGG + Intronic
1098300219 12:69046712-69046734 AGAAAAAAAAGGCAAGGCTAGGG - Intergenic
1098888409 12:75983420-75983442 GGAAAATGAAAGTAAGGGTGAGG - Intergenic
1099520393 12:83653403-83653425 AAGAAATCTAGGCAAGGATGTGG + Intergenic
1100022819 12:90090481-90090503 AGGAAAGAAAGGGAAGGGTGGGG - Intergenic
1100080442 12:90842648-90842670 AGCAAGTCAAGGCAAGGTTTTGG + Intergenic
1102143586 12:110637173-110637195 AGAAAATAATGGCAAAGCTGAGG - Intronic
1102856901 12:116302149-116302171 AGAAAATCAAGACAATGAAGAGG - Intergenic
1103069128 12:117926246-117926268 AGAAAACCAAGGCTGGGATGGGG - Intronic
1103126310 12:118425549-118425571 TGAAAATGAAGGAACGGGTGGGG - Intergenic
1103303435 12:119945677-119945699 AGAAAAACAAAACAAGAGTGAGG + Intergenic
1104019841 12:124984618-124984640 AAAAAAACAAGAAAAGGGTGAGG + Intronic
1104322586 12:127765640-127765662 AGGAAATAAAGGCAAAAGTGAGG + Intergenic
1104617243 12:130281137-130281159 AAAAAATAAAGGGGAGGGTGGGG + Intergenic
1105845864 13:24293013-24293035 AAAAAAAAAAGGCGAGGGTGTGG + Intronic
1106325778 13:28687954-28687976 ATAAACTCAAGGTAAAGGTGTGG - Intergenic
1106917810 13:34534123-34534145 GGAAAATCAAGGAAGAGGTGGGG - Intergenic
1106949734 13:34870024-34870046 AGAAGATACAGGCAGGGGTGAGG + Intergenic
1107238075 13:38197457-38197479 AGAAAAACAAGGCGGCGGTGGGG + Intergenic
1107526578 13:41238458-41238480 AGAAAAAGAATGCAAGTGTGGGG + Intronic
1107834106 13:44399757-44399779 AGAAAATCAAGCCTTGGTTGGGG + Intergenic
1107969220 13:45625179-45625201 AGGACATCAAGTCAGGGGTGGGG - Intergenic
1108443521 13:50481251-50481273 AGAAAATCCAGCCAAGAATGAGG + Intronic
1108530149 13:51320916-51320938 AGAAGATGAAGGCAGAGGTGGGG - Intergenic
1108761913 13:53577959-53577981 AGAAAATCAAGGCAATAGAAAGG + Intergenic
1109200588 13:59426504-59426526 AAAAAATCAAGAAAAGAGTGGGG + Intergenic
1109571770 13:64201871-64201893 AGAAAATCAAAGAAAAGGTGAGG + Intergenic
1109862512 13:68218825-68218847 AAAAAATCAGAGAAAGGGTGAGG - Intergenic
1110500794 13:76225395-76225417 AGAAAATTCAGGCAAGGAGGGGG - Intergenic
1110620252 13:77586543-77586565 AGAGAATGATGGCAAGGGAGTGG - Intronic
1112258208 13:97853827-97853849 CCAAAAACAAGACAAGGGTGGGG + Intergenic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1113101054 13:106719560-106719582 AGAAATCCAAGGCAAAGATGTGG + Intergenic
1115288942 14:31748905-31748927 ATAAAAACAAAGCAGGGGTGGGG - Intronic
1115617865 14:35113436-35113458 AGAAAAAGAAGGCAAAGGTTTGG + Intronic
1116202501 14:41816149-41816171 AGAAAATAGAGGGAAGGGAGGGG - Intronic
1116293427 14:43073358-43073380 AGACAATAAAGTCAAGGCTGAGG + Intergenic
1117095346 14:52291622-52291644 ACGGAATCAAGGCAAGGATGAGG + Intergenic
1117498650 14:56330671-56330693 AGAAAATCGAGTCAAGGTTGTGG - Intergenic
1117627413 14:57653995-57654017 TGAAGATGAAGGCAGGGGTGGGG - Intronic
1117866220 14:60152338-60152360 AGAAAATCTAGTCAAGGCAGAGG - Intronic
1117933534 14:60874391-60874413 ACAAAAGCAAGGCAATGGGGAGG - Intronic
1117989044 14:61416017-61416039 AGAAAAAAGAGGCAAGGGAGGGG - Intronic
1118105964 14:62659982-62660004 AGAAAAGGAAACCAAGGGTGTGG + Intergenic
1118648503 14:67865229-67865251 AAAAAAAAAAGGCAAGGGGGAGG - Intronic
1119683974 14:76615500-76615522 AGATAAAGTAGGCAAGGGTGGGG + Intergenic
1119910178 14:78342718-78342740 AGAAAATCTAGGAAAGGCTTTGG - Intronic
1120281953 14:82450360-82450382 AGAAAAGCAAAGCAAAGGGGAGG - Intergenic
1121130098 14:91438227-91438249 AGAAAATGAAGTCCAGGCTGAGG + Intergenic
1122293244 14:100690826-100690848 AGAAAACCAAAGCTAGGGAGGGG - Intergenic
1122425427 14:101602673-101602695 AGAAGATCAACCCAAGAGTGAGG + Intergenic
1124178406 15:27449106-27449128 AGAAAAGCAGGGCAAGGATGAGG - Intronic
1125887749 15:43241174-43241196 AGAGATTCTAGGCAAAGGTGGGG + Intronic
1126582334 15:50252985-50253007 GGAAGAAAAAGGCAAGGGTGAGG - Intronic
1126783897 15:52161225-52161247 AGAAAATCAAGGAGTAGGTGAGG + Intronic
1127688652 15:61373176-61373198 AGCAACTGAAGCCAAGGGTGAGG + Intergenic
1127717051 15:61658795-61658817 AGACAAATGAGGCAAGGGTGAGG - Intergenic
1128371083 15:67039836-67039858 AGAAACTCAGGTGAAGGGTGTGG + Intergenic
1128439951 15:67697098-67697120 AGAAATAGAAGGCATGGGTGAGG + Intronic
1129090594 15:73146032-73146054 AGGAAAGCCAGGCAAGGGAGTGG - Intronic
1129238355 15:74237134-74237156 AGAAAATCAGGGCCAGGGATTGG - Intronic
1129576605 15:76755756-76755778 AGAAAATCAGAGAAAGAGTGGGG - Intronic
1129776185 15:78237886-78237908 AGAAAATGAAGGGACAGGTGAGG - Intronic
1130243189 15:82217649-82217671 AGAAAAGCAAGAGAAGGATGTGG + Intronic
1130917354 15:88315835-88315857 AGAAAACCCAGGAAAGTGTGAGG - Intergenic
1131686835 15:94777399-94777421 GGGAAATCAAGGAAAGGGAGAGG - Intergenic
1132828253 16:1915569-1915591 AGAAAAGCAAGAGGAGGGTGGGG - Intronic
1132845913 16:2000750-2000772 AGAAAAACAAGCCAGGCGTGGGG + Intronic
1133628958 16:7600541-7600563 AGAAAATTAAGCCATCGGTGAGG + Intronic
1134250064 16:12568167-12568189 GGAAAATCAAGGAAAATGTGGGG + Intronic
1134291471 16:12905223-12905245 AGAAAATCATGGCTCAGGTGAGG + Intronic
1135025994 16:18999415-18999437 AGAAAAATAAGTCAGGGGTGCGG - Intronic
1135384726 16:22027820-22027842 AGAAACTGAAGGCAAGGGCTAGG - Intronic
1135966957 16:27043653-27043675 AGCAAATCCTGGCAAGGATGTGG - Intergenic
1135997062 16:27258437-27258459 AGAACATCCAGGAAAGGGTTTGG - Intronic
1136060394 16:27722463-27722485 AGAGAAGGAAGGAAAGGGTGTGG - Intronic
1138106680 16:54290751-54290773 AGAAAAAAAAGGCATGGGGGAGG - Intergenic
1138370213 16:56520629-56520651 AGAAAATTAAGGGAAGGAAGAGG + Intergenic
1138396178 16:56706518-56706540 AGAAAAACAAGGGCCGGGTGTGG - Intronic
1138404206 16:56775824-56775846 AGACAACCATGGCAAGGGAGGGG - Intronic
1138675314 16:58647002-58647024 TGAAAAGCAAGGCAAGGGCCAGG - Intergenic
1138880223 16:61004498-61004520 AGAAAATGGAGGGAAAGGTGTGG + Intergenic
1138896105 16:61206689-61206711 AGAAGATAAAACCAAGGGTGTGG + Intergenic
1139206304 16:65032338-65032360 AAAAAATCCAGGCATGGGGGTGG + Intronic
1139312378 16:66038469-66038491 ATAAAATCAAGGTATTGGTGGGG - Intergenic
1139726848 16:68907083-68907105 AAAAAATCAAGGTCTGGGTGAGG - Intronic
1140315586 16:73893592-73893614 AAAAAAATAAGGCAGGGGTGGGG - Intergenic
1140527496 16:75635603-75635625 GGAAAAGGAAGGCAAGGGAGAGG + Intronic
1140610239 16:76590116-76590138 AGAAAATAAAGGCAACGGGCTGG + Intronic
1140618925 16:76703601-76703623 AACAAATAAAGGCAAGGCTGAGG + Intergenic
1140660859 16:77190572-77190594 AGAAAGTCAAGGGAGGGGAGAGG - Intergenic
1140835536 16:78790679-78790701 AGAAAATCAAAACAAGACTGTGG + Intronic
1141488886 16:84358649-84358671 GGAAAGTCAAGGGAAGGCTGTGG - Intergenic
1142820001 17:2458419-2458441 AAAAATTCAGGGCCAGGGTGTGG + Intronic
1143329180 17:6121297-6121319 AGAAAAGAGAGGCAAGGCTGCGG - Exonic
1143635395 17:8161596-8161618 AAAACCTCAAGGTAAGGGTGGGG - Exonic
1143836745 17:9699086-9699108 GGAAACGCAAGGCATGGGTGGGG + Intronic
1143912575 17:10263844-10263866 AGAAAATCTAGGGACGAGTGTGG - Intergenic
1144097056 17:11909458-11909480 AGAAACACAAGGCAAGGCAGGGG - Intronic
1144336684 17:14277827-14277849 AGAAAACCAAGTAAAGAGTGTGG + Intergenic
1144508689 17:15856630-15856652 GGAAAATGAAGTCCAGGGTGAGG + Intergenic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1145172807 17:20674270-20674292 GGAAAATGAAGTCCAGGGTGAGG + Intergenic
1146143636 17:30390429-30390451 AGAAAATCAAGGCCTGAGAGAGG + Intronic
1146839854 17:36143656-36143678 AGAAACTTCAGGCAAGGGGGTGG - Intergenic
1148347103 17:46910652-46910674 GAACAATCAAGGCAAGGGAGTGG + Intergenic
1149328176 17:55554808-55554830 AGGAAATCAAAGGCAGGGTGAGG - Intergenic
1149593699 17:57850497-57850519 AGAAAACCAAGGCCGGGGAGGGG + Intergenic
1149625570 17:58078092-58078114 AGAAAATCAAGACAATGATATGG - Intergenic
1149796953 17:59529628-59529650 ACAAAATTAAGCCAAGCGTGTGG - Intergenic
1150878073 17:68992250-68992272 AGAAAATGAAGGTAAGGCTAGGG + Exonic
1151103730 17:71587842-71587864 AGAAAATCAAGCAAAGGAAGGGG + Intergenic
1151476636 17:74347883-74347905 AGAACATTAAGACTAGGGTGAGG + Exonic
1151646180 17:75433509-75433531 TGAAAATCAAGGCAGGGATCTGG + Intergenic
1151678051 17:75609979-75610001 AGAAAAGCAAGGGTCGGGTGCGG - Intergenic
1153613572 18:6911729-6911751 AGAAAATTATGGCAAGGGCTGGG - Intronic
1155429294 18:25738541-25738563 GGAAAATTAAAGCAAGCGTGTGG - Intergenic
1155893392 18:31293824-31293846 GGCAAATCAATGCAATGGTGTGG - Intergenic
1155912600 18:31521871-31521893 ACAAGATGAAGGCAAGGCTGAGG - Intronic
1156752276 18:40473719-40473741 AAAAAATAAAGGAAAGGATGAGG + Intergenic
1156942293 18:42783199-42783221 AGGAAACCAAGGCAAAAGTGAGG + Intronic
1157117919 18:44879809-44879831 AGTCAATGAAGGCAAGTGTGAGG - Intronic
1157319021 18:46620185-46620207 AGAGAATCAAGGCTGGGGGGCGG - Intronic
1157395473 18:47337518-47337540 AGGAAATCAAGGTGAGTGTGAGG - Intergenic
1157928375 18:51791275-51791297 AGAAAGTGAAGGTAATGGTGGGG + Intergenic
1159089689 18:63833668-63833690 AGAAAAAAAAGGCAGGGGAGTGG + Intergenic
1159134289 18:64318831-64318853 AGAAAAAGAAAGAAAGGGTGAGG - Intergenic
1159339198 18:67112790-67112812 ATAAAATCCTGGCAAGGATGTGG - Intergenic
1159749663 18:72284688-72284710 AGAACATGGAGGGAAGGGTGTGG - Intergenic
1159890119 18:73945059-73945081 GGAACATCAAGGCAGGGGAGAGG - Intergenic
1160675392 19:388528-388550 AGAAATTCAAGTTAAGGGCGGGG + Intergenic
1161612009 19:5248396-5248418 AAAAAATCATGGAATGGGTGTGG + Intronic
1162307771 19:9885779-9885801 TGAAAGTCAGGGCAGGGGTGAGG - Intronic
1162346062 19:10118856-10118878 AGAAGTTCAAGGTGAGGGTGGGG - Exonic
1162848674 19:13413942-13413964 AGAAAAGGAAGGCAAGGGAAGGG + Intronic
1164659126 19:29948214-29948236 AGAAAATAAAGGCAATCTTGAGG - Intronic
1165043803 19:33088331-33088353 AAAAAAAAAAAGCAAGGGTGAGG - Intronic
1166302837 19:41921976-41921998 GTAGAATGAAGGCAAGGGTGGGG - Intronic
1167113600 19:47476015-47476037 AAAAAAAAAAGGCCAGGGTGTGG + Intronic
1167198319 19:48046222-48046244 TGAAAATCAAGGAAAGATTGAGG + Intergenic
1167242355 19:48351813-48351835 AGAAAAGGAAAGCAAGGGAGGGG - Intronic
1167922004 19:52789677-52789699 AGGAGATCAAGGCTATGGTGAGG + Intronic
1167999371 19:53432429-53432451 AGCACCTTAAGGCAAGGGTGGGG - Intronic
1168333995 19:55586426-55586448 AGAAAATTAAGGCAAGGTGAAGG - Intergenic
925855438 2:8124876-8124898 AGAAAAGCAGGGCGGGGGTGGGG - Intergenic
926724313 2:15985156-15985178 GGAAAAGCAAGGAGAGGGTGAGG - Intergenic
928156488 2:28881581-28881603 AGAAAAATAAAGCAAGGCTGAGG - Intergenic
929069723 2:38017850-38017872 AGCAAAGGAAGGTAAGGGTGGGG + Intronic
929742202 2:44614601-44614623 AGAAAAACAAGGCAAGGAAGGGG + Intronic
930072296 2:47376548-47376570 GGAACATCAAGGCTCGGGTGAGG - Intronic
931180125 2:59891245-59891267 AGACAAGCAAGGCACTGGTGAGG + Intergenic
931209133 2:60176042-60176064 AATAAATCAAGGCAGGGATGTGG - Intergenic
931437665 2:62262925-62262947 AGAAAGTGAAGGCAAAGATGAGG - Intergenic
931849733 2:66240121-66240143 AGAATTTCAAGGGAAGGGGGAGG + Intergenic
932507966 2:72255047-72255069 TGGATATCAAGCCAAGGGTGTGG + Intronic
932624124 2:73284440-73284462 AGGAAAGCAAGGGAAGGGGGAGG + Intergenic
935040368 2:99420469-99420491 AGAAAGGCAAGGCAGGGCTGAGG - Intronic
936000539 2:108823978-108824000 AGAAAAAAAAGGGAGGGGTGGGG + Intronic
937039487 2:118809783-118809805 ATAAAATTAAGAAAAGGGTGGGG - Intergenic
937273339 2:120669279-120669301 ACAAACTCCAGGCATGGGTGTGG + Intergenic
937764120 2:125640086-125640108 ATAAAATCAAGGAAGGGGAGAGG + Intergenic
937864777 2:126741394-126741416 AGAAAATCAAGTCATGGGGGTGG + Intergenic
940603307 2:155888170-155888192 TGAAAATCTTGGCAAGGATGTGG + Intergenic
940673386 2:156698304-156698326 AAAAAATGAAGGAAAGGATGAGG + Intergenic
941480301 2:166000640-166000662 ACAAAAGCTAAGCAAGGGTGTGG + Intronic
942055297 2:172176793-172176815 AAAAAATTCTGGCAAGGGTGTGG - Intergenic
942946439 2:181679510-181679532 AGAAAAGAAAGGCGAGGGAGGGG - Intronic
943423250 2:187697172-187697194 AGACAATGAAGTCAAGGCTGAGG + Intergenic
943840536 2:192574579-192574601 AGAAAATGAAGGCAAGGGAAGGG + Intergenic
944413523 2:199463289-199463311 GGGACAACAAGGCAAGGGTGGGG + Intronic
944665424 2:201955307-201955329 AAAAAATAAAGGCAAGGATTGGG + Intergenic
944982980 2:205143566-205143588 AGAAAAGCAGGACAAGGGTAAGG - Intronic
945020195 2:205563247-205563269 GAACAATCAAGGCAAGGGAGAGG + Intronic
945028142 2:205638810-205638832 TGCACATAAAGGCAAGGGTGGGG - Intergenic
946188202 2:217993592-217993614 TGAAAATCAAGGAAAGGCTGAGG + Intronic
946251864 2:218418927-218418949 AAAAAAAAAAGCCAAGGGTGGGG + Intergenic
946475757 2:220005099-220005121 AGAAAACAAAGGCCAGAGTGGGG + Intergenic
947070909 2:226287260-226287282 AGAGCAGCAAGGCAAGGGTGAGG + Intergenic
947152583 2:227130503-227130525 AGCAAATCAAGGCAAGGCCAAGG - Intronic
948136026 2:235636881-235636903 AGAACATCATGTCAAGGCTGCGG + Intronic
948224539 2:236298897-236298919 CTGAAATCAAGGCATGGGTGGGG - Intergenic
948875519 2:240825247-240825269 AGAGCATCAAGCCAAGAGTGCGG + Intergenic
1168865935 20:1086585-1086607 AGAAGATCAAGCCCAGTGTGGGG + Intergenic
1169375016 20:5059580-5059602 ATAAAATAAAGGCAAGGATATGG - Intergenic
1169997093 20:11570791-11570813 CTAAAATCAAGGCACTGGTGAGG + Intergenic
1170361035 20:15546624-15546646 AGCACATCAATGCAAAGGTGAGG + Intronic
1170472280 20:16680260-16680282 ATAAAAGCAAACCAAGGGTGTGG + Intergenic
1170618639 20:17975655-17975677 AGAAAATCAGGGAAAAGGGGAGG - Intronic
1170694221 20:18643733-18643755 TGAAAATCAAGGAAAGACTGAGG - Intronic
1170701162 20:18704817-18704839 AGATGATCAAGGAGAGGGTGGGG + Intronic
1170831687 20:19848068-19848090 AGAAAATAAAAGCAAGGGGGAGG + Intergenic
1172839064 20:37891119-37891141 TGAAAGTTCAGGCAAGGGTGGGG - Intergenic
1173810274 20:45951185-45951207 AGAAAATCAGGGCCAGGGCCGGG - Intronic
1174451097 20:50620970-50620992 AGTTCATCAAGGAAAGGGTGGGG + Intronic
1175163009 20:57022620-57022642 TGGAAATCAAGGGAAGGGTCTGG - Intergenic
1175578845 20:60083071-60083093 AGAAAAACACGGCAAGTTTGTGG + Intergenic
1178049175 21:28729853-28729875 AGAAAAACTGGGCAAGGGAGTGG - Intergenic
1179095745 21:38313216-38313238 AGCAAAGCAAAGCAAGTGTGGGG - Intergenic
1179118663 21:38521198-38521220 AGAAAATGAAGGGAACTGTGTGG - Intronic
1179543795 21:42101049-42101071 AGAAAATCAAGGCTGGGAAGTGG - Intronic
1179567641 21:42259110-42259132 AGAAAATCCAGCTAAGGCTGGGG - Intronic
1179831863 21:44001845-44001867 AGAACAGCAAGGAAAAGGTGGGG + Intergenic
1181042968 22:20201573-20201595 AGAAATTCAAGTCAGGGCTGAGG + Intergenic
1181547231 22:23608999-23609021 GGAGAATGGAGGCAAGGGTGTGG - Intronic
1181580203 22:23824011-23824033 AGAAAATGGAGAGAAGGGTGTGG + Intronic
1182546533 22:31080056-31080078 AGAAAACCAAGGCACGGGCCAGG - Intronic
1182918977 22:34062065-34062087 AGAAACTAAAGGAAAGGGAGAGG - Intergenic
1184563118 22:45274873-45274895 AGAGCTTCAAGGCAGGGGTGGGG + Intergenic
950507011 3:13401271-13401293 AAAAAAAAAAGGCAATGGTGCGG + Intronic
951738727 3:25896700-25896722 AGAAAATCCACCCAAGGGTATGG - Intergenic
951775712 3:26308296-26308318 AGAATATCAAGCCAAGTGTTGGG - Intergenic
951977902 3:28534199-28534221 AGAAAACCAAAACAAGGATGGGG + Intronic
952738615 3:36714288-36714310 ACAAAATCTAGTCAAGAGTGTGG - Exonic
953013697 3:39052385-39052407 AGAAAGACAGGGCAAGGGGGAGG - Intronic
953466777 3:43128771-43128793 AGCAATGCAAGGGAAGGGTGTGG - Intergenic
954152731 3:48665712-48665734 AGAAGACCAGGGTAAGGGTGTGG + Intergenic
954854598 3:53633195-53633217 AGAAAACCAAGGCAAGGGCTGGG + Intronic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
955302607 3:57796881-57796903 AAAAATTCAAGGCAAGGGGCTGG + Intronic
956146804 3:66198818-66198840 AGAGAGTCAAGGTAAGGGTCAGG - Intronic
956775760 3:72564314-72564336 AGAAACTCAAGACAACAGTGAGG - Intergenic
958874252 3:99597683-99597705 AGAAAGACAAGGAAAGGCTGAGG - Intergenic
958890579 3:99778010-99778032 AGAAATTCATGGCAAGGATGTGG + Intronic
959368275 3:105490996-105491018 AGAAGTTCACTGCAAGGGTGGGG - Intronic
960166949 3:114413191-114413213 ATAAAATCCAGGCAAGGATATGG + Intronic
961787740 3:129357774-129357796 AGAACAGAGAGGCAAGGGTGGGG + Intergenic
963287777 3:143452408-143452430 AAAAAAGCAAGTCCAGGGTGTGG + Intronic
963349133 3:144131601-144131623 AGAAAAAAAAGGAAAGTGTGTGG - Intergenic
964703015 3:159589901-159589923 AGAAAATGAAGGCAAGTGTTAGG + Intronic
965611032 3:170544036-170544058 AGAAAATGCAGGCCCGGGTGTGG - Intronic
966105248 3:176326154-176326176 AGAAAATCAGAGAAAGGGTTGGG + Intergenic
966552046 3:181216138-181216160 AGGAACTCTATGCAAGGGTGAGG - Intergenic
966754857 3:183359689-183359711 AGTAAACTAAGGCACGGGTGTGG + Intronic
966828962 3:183989491-183989513 AGAAATTCCAAGCAAGGGTCAGG + Intronic
967082865 3:186066275-186066297 AAAAAATCAAAGCAATGATGTGG + Intronic
967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG + Intronic
967380087 3:188848043-188848065 AAAAACTCAAGGCAAGGATGAGG - Intronic
967487064 3:190045279-190045301 AGAAAATTAATGCAATTGTGTGG + Intronic
968267332 3:197372402-197372424 AGAAAATGAAGGCCAGGAAGGGG - Intergenic
968481273 4:834116-834138 AGAAAAGTCAGGCAAGGGAGGGG + Intergenic
968938046 4:3623926-3623948 AGAAACTAAAGGCAAAGTTGGGG + Intergenic
969726656 4:8922161-8922183 AGGAAAACCAGGCAAGGGAGAGG - Intergenic
970197809 4:13570138-13570160 GCAAAGTCAAGGCAATGGTGAGG + Intronic
970224193 4:13840268-13840290 AGAAAATTCAAACAAGGGTGGGG + Intergenic
970595746 4:17598565-17598587 ACAAAATCAAGGCAAGTGCGCGG - Intronic
971485919 4:27160066-27160088 AGAAAAATAAAGCAAGGGTAGGG - Intergenic
972718802 4:41675451-41675473 GAAAAAGCAAGGCACGGGTGGGG - Intronic
974519098 4:62957836-62957858 AGGAAATGAAGGTATGGGTGAGG + Intergenic
974860070 4:67509778-67509800 AGAAAAACAAGGCTAGGGAGGGG - Intronic
974860369 4:67513218-67513240 ATAAAATCAAGGTATTGGTGGGG - Intronic
976484935 4:85590653-85590675 AGAAAAAGAAGGAAAGGGTCAGG - Intronic
978707143 4:111727191-111727213 AGAAAATTAAAGCAAGGGTCAGG - Intergenic
979524134 4:121699215-121699237 AGAAAATAAAGGCTAGGGAATGG + Intergenic
980036067 4:127883543-127883565 AGAAAATGAAGGTAGGTGTGTGG + Exonic
982264711 4:153527636-153527658 ATTAAATCAGGGCAGGGGTGGGG - Intronic
982385563 4:154797575-154797597 AGAAAATCAAGGGAGTGGTCAGG - Intronic
983103296 4:163653051-163653073 AGAAAATCAAGGTAAGGGGATGG + Intronic
983354470 4:166638039-166638061 AGAGAATCATGGCTTGGGTGGGG - Intergenic
983631041 4:169849600-169849622 AGAAAACCAAGTCTAGGGTGGGG + Intergenic
983754844 4:171322047-171322069 AGAAACTTAAGGTAAAGGTGTGG + Intergenic
983759754 4:171391133-171391155 AGAAAAATAAGGCAAGAGTTGGG - Intergenic
984981516 4:185286484-185286506 AGAAAAATGAGGGAAGGGTGAGG + Intronic
985888668 5:2699479-2699501 GGAAGACCAAGGCAGGGGTGGGG + Intergenic
986661137 5:10061243-10061265 AGATAATCATGGCAGGGGTGTGG + Intergenic
986680859 5:10231631-10231653 AGCAAAGCAAAGCAAGGGCGGGG - Intronic
986820268 5:11458975-11458997 AGAAGTTCAAGACCAGGGTGGGG - Intronic
986974068 5:13375047-13375069 AAAAAATCAGGCCAAGGCTGTGG - Intergenic
987749964 5:22026750-22026772 AGAAACTCAAGACAGGAGTGTGG - Intronic
987879538 5:23725054-23725076 AGAAAATGAAGGCAAAGAAGAGG - Intergenic
988087910 5:26495574-26495596 AAAATATCAAAGCAAGGTTGTGG + Intergenic
988594113 5:32575300-32575322 CGAAAATCAAGGCAACGGGAGGG + Intronic
989375701 5:40757536-40757558 AGAAAAACAAGGAAAGGGAAAGG + Intergenic
990337967 5:54793693-54793715 AGCCAATCAAGGAGAGGGTGAGG - Intergenic
990503481 5:56421585-56421607 AAAATAACAAGGCAAGGCTGTGG + Intergenic
990673239 5:58156177-58156199 AGAAAGGAAAGGCAAGGATGTGG - Intergenic
991728239 5:69558696-69558718 ATAAAATAAAGGCAATGGAGGGG + Intergenic
991866716 5:71069179-71069201 ATAAAATAAAGGCAATGGAGGGG - Intergenic
992013828 5:72556783-72556805 AGACAAGCAGGGCAGGGGTGAGG + Intergenic
992688362 5:79219492-79219514 AAAAAAACAAGGCGCGGGTGTGG - Intronic
993305579 5:86271495-86271517 AGAACCACAAGGCAAGGGTTTGG + Intergenic
993773889 5:91966677-91966699 GGAAAATCGAGGAAAGGGTAAGG - Intergenic
993840060 5:92866609-92866631 AGAATATCAGGGTAGGGGTGAGG - Intergenic
994265398 5:97710138-97710160 AACAAATCCTGGCAAGGGTGTGG + Intergenic
995198153 5:109396767-109396789 AAAAAAAAAAGGCAGGGGTGGGG + Intronic
995478490 5:112571747-112571769 AAAAGAACAAGGGAAGGGTGTGG + Intergenic
995907915 5:117148302-117148324 GGAAAATCATCGGAAGGGTGAGG + Intergenic
997106246 5:131022203-131022225 AGAAAAGCAAAGAAATGGTGTGG + Intergenic
997326120 5:133022958-133022980 AGAAAATCAATACAAGGCAGGGG + Intronic
998671260 5:144356863-144356885 AGAAAATGAAGACAAGAGAGGGG - Intronic
999151761 5:149430858-149430880 AGAAAAGCAACGCAAAGGTTTGG - Intergenic
999614612 5:153409021-153409043 AGAAAAACAAGGAAAGACTGAGG + Intergenic
1000274641 5:159722682-159722704 AGAAAAACAAAACAAGTGTGGGG - Intergenic
1000540959 5:162539139-162539161 GGAAAATAAAGCTAAGGGTGTGG + Intergenic
1000844767 5:166265686-166265708 AGAAAAGCCAGGCAAGTGTGGGG - Intergenic
1002054824 5:176592770-176592792 AGGAAATCAAGGCAAGATGGGGG + Exonic
1002092884 5:176815122-176815144 GGAAAATCCATGCCAGGGTGGGG - Intronic
1002787538 6:415071-415093 AGACAATGAAGGCCAGGCTGAGG + Intergenic
1003069018 6:2929541-2929563 AGAAATTCAAGGCAAGTCTCAGG + Intergenic
1004082842 6:12412631-12412653 AGAAACTCAGGGCAAAGGAGGGG + Intergenic
1004226659 6:13791024-13791046 AGAAAATAAAATAAAGGGTGTGG - Intronic
1004263247 6:14126973-14126995 AAAAAATAAAAGCAGGGGTGGGG - Intronic
1004798399 6:19115718-19115740 AGAAACAAAATGCAAGGGTGGGG - Intergenic
1005247457 6:23904574-23904596 AAAAAAACCACGCAAGGGTGTGG - Intergenic
1005653747 6:27910498-27910520 AGAAAATTAAGACAAGGTTTTGG + Intergenic
1006510302 6:34517746-34517768 AGGAAAGCAAGGCAGGGGAGGGG - Intronic
1006657442 6:35607839-35607861 AGTTCATCAAGACAAGGGTGGGG + Intronic
1008057003 6:46955615-46955637 AGAACATTAAAGCAAGTGTGGGG + Intergenic
1008320773 6:50110917-50110939 AGAAACTCAAGGCTTGGGAGTGG - Intergenic
1008407034 6:51129945-51129967 AGAAAATCTATCCAAGGGTCAGG + Intergenic
1008516839 6:52326550-52326572 AGAAAGACAAGGAAAGGCTGAGG - Intergenic
1009617808 6:66032888-66032910 AGAAAAACAATGAAAGGATGTGG - Intergenic
1010533690 6:76996985-76997007 CCATAACCAAGGCAAGGGTGAGG + Intergenic
1010534807 6:77013417-77013439 AAAAAATCGAGGCAAGGGAAAGG + Intergenic
1010585333 6:77651197-77651219 GAAAAATAAAGGCAAGAGTGAGG + Intergenic
1010846555 6:80716269-80716291 AGAAAATAAAGGCACAGGGGTGG + Intergenic
1010865416 6:80970723-80970745 GGGAAATCAAGGCAAGGGAAAGG - Intergenic
1011041010 6:83030830-83030852 GGAAAATAAAGTCCAGGGTGAGG + Intronic
1011092112 6:83615247-83615269 CAAAAAACAAGGGAAGGGTGTGG + Intronic
1012337321 6:98077111-98077133 AGAAAAGGAAGGGAAGGGAGGGG + Intergenic
1013639300 6:112057719-112057741 GAAAACTGAAGGCAAGGGTGTGG + Intronic
1014538799 6:122649516-122649538 AGAAGATAAAGGCAGGAGTGGGG + Intronic
1015249518 6:131112505-131112527 AAAAAATGCTGGCAAGGGTGTGG - Intergenic
1015785035 6:136914708-136914730 AGAAAGTGGAGGCAAGAGTGGGG + Intergenic
1016650453 6:146454950-146454972 AGAAAAGCAAAGAAAGGGTTGGG + Intergenic
1017016902 6:150108424-150108446 AGGAAATCAAGGCCAGGCTAAGG - Intergenic
1017214743 6:151897543-151897565 ATAAACTTAAGGTAAGGGTGTGG - Intronic
1017780742 6:157713519-157713541 GGAAAAGCGAAGCAAGGGTGAGG + Intronic
1018720255 6:166566652-166566674 GGAGATTCCAGGCAAGGGTGGGG - Intronic
1018752921 6:166822690-166822712 AGAAAATCAGGACAAAGATGTGG + Intronic
1019767538 7:2862925-2862947 AGAAAACCAAGGGCCGGGTGCGG - Intergenic
1020220477 7:6232799-6232821 AGGAAATCATTGGAAGGGTGTGG - Intronic
1020924070 7:14301994-14302016 AGAGAATCAAAGCAAAGCTGTGG - Intronic
1021653518 7:22853892-22853914 AGAAACACCAGGCAAGGGAGGGG + Intergenic
1021689716 7:23220108-23220130 CCAAAATCAGGGCGAGGGTGTGG + Intergenic
1022547486 7:31202299-31202321 AGAGAATCAAGGCTACTGTGGGG + Intergenic
1022640232 7:32175170-32175192 AGAAGATGAAGGCAAGTGAGAGG - Intronic
1022728267 7:32999888-32999910 TGAAAATCCAGGCAAGACTGTGG - Intronic
1024343829 7:48292740-48292762 AGGAAAATAAGGCAGGGGTGGGG - Intronic
1024469434 7:49752078-49752100 AGAAAATAAAAGCAAAGGTGAGG + Intergenic
1024656786 7:51457820-51457842 AGAAAATGAACCCAAGGCTGAGG - Intergenic
1024972350 7:55082340-55082362 AGAAAATGTGGGCAGGGGTGGGG - Intronic
1025017168 7:55449120-55449142 AAAAAATAAAGGCATGGGTTTGG + Intronic
1025045384 7:55688129-55688151 TGAAAATCCAGGCAAGACTGTGG + Intergenic
1025953975 7:66168623-66168645 AAAAAAAAAAGGCAAGGGTGGGG - Intergenic
1025996326 7:66529714-66529736 AGGAGATCAAGGCAAGCATGAGG + Intergenic
1026136048 7:67662011-67662033 TGAAAGTCAAGGAAAGGCTGAGG - Intergenic
1027525867 7:79267840-79267862 GGAAAATAAAGGCAATGTTGAGG + Intronic
1028167840 7:87559514-87559536 AGAAAATAAAGGCAAAAGAGTGG - Intronic
1028264403 7:88705362-88705384 AGAAATGGAAGGCAAGAGTGAGG - Intergenic
1028471403 7:91210764-91210786 AGCAAATCAAGGAAAGGGGAGGG - Intergenic
1028698798 7:93751565-93751587 ATGAAGTCATGGCAAGGGTGTGG - Intronic
1028759233 7:94476421-94476443 AGAAAGTAAAGGAAAGGGTTTGG - Intergenic
1029010361 7:97254340-97254362 AGAAAATGTTGGCAAGGATGTGG + Intergenic
1029639416 7:101810125-101810147 AGAAAATGTAGGCCCGGGTGTGG + Intergenic
1030026064 7:105325946-105325968 GGAAAAACAAGGCAATGCTGAGG + Intronic
1030289388 7:107857191-107857213 TGAAAAACAGGACAAGGGTGGGG + Intergenic
1030470505 7:109957245-109957267 AGAAAAACAATGCAAGACTGAGG + Intergenic
1030821958 7:114104271-114104293 AGAAAATACAGGCAAGGCTGTGG + Intronic
1031022400 7:116642516-116642538 TGAAAATCAAGGCATTGGTAGGG - Intergenic
1031693224 7:124816820-124816842 AGAAAAATAAGGCAGGGGTGGGG + Intergenic
1031929743 7:127672754-127672776 TGAAAATCAAGGAAAGACTGAGG - Intronic
1032470433 7:132174673-132174695 AGAAAACTAAGGCCAGGGAGGGG - Intronic
1032791814 7:135248000-135248022 GGAAAGTCAGGGCAAGGGGGTGG - Intronic
1033628337 7:143132848-143132870 AGAAAATGGAGCCAAGGGTCTGG + Intronic
1034484973 7:151354311-151354333 AAAAAAAAAAAGCAAGGGTGGGG - Intronic
1035430664 7:158818302-158818324 AGCAAATCAAGGCAAGGAAGAGG + Intronic
1035762001 8:2075358-2075380 AGGAAAATAAGGCAAAGGTGGGG + Intronic
1036122363 8:6032341-6032363 AGAAAATAAAGACAAGGAGGAGG + Intergenic
1036449282 8:8851673-8851695 AGAAAAACAAGGCAAGAGGAAGG - Intronic
1036990569 8:13588316-13588338 AGAGAATCCAGGAAAGGGAGAGG + Intergenic
1037183606 8:16035437-16035459 AGAAAAACCAGGTAAGGGTGGGG - Intergenic
1037556958 8:20034227-20034249 AGAAAATCAAGCCAAGAGGCAGG - Intergenic
1037826914 8:22165175-22165197 AGAAAAAGAAGGAAAGGGAGAGG + Exonic
1038252058 8:25914133-25914155 AGAAAATGAACTCATGGGTGTGG - Intronic
1038479103 8:27889191-27889213 AGAAGATCAAGGCATGGGTCTGG + Intronic
1038752947 8:30313802-30313824 AGTAAATAAATGCATGGGTGGGG + Intergenic
1038784348 8:30597380-30597402 AAAAGATTGAGGCAAGGGTGTGG - Intronic
1038890274 8:31713546-31713568 AGAAAATGAAGTGAAGAGTGAGG - Intronic
1039964801 8:42276234-42276256 AACAAATGAAGGCAAGGATGTGG - Intronic
1040303161 8:46198526-46198548 AGAAACTCAAGGATAGGTTGAGG + Intergenic
1040342695 8:46448906-46448928 AGAAACTCAAGGGTAGGTTGAGG - Intergenic
1041306712 8:56469341-56469363 AGAGAATCAAGGAAAGGGAGAGG - Intergenic
1041367845 8:57128124-57128146 AGAAAGTGAAGTCAAGGGTCTGG + Intergenic
1041700663 8:60785805-60785827 AAAAAATCAAAGGAAGGCTGAGG - Intronic
1042524940 8:69754255-69754277 ACAAAATCATGGGAAGGGAGAGG + Intronic
1042871512 8:73404419-73404441 AGTGAATCAAGACACGGGTGTGG - Intergenic
1043378147 8:79672958-79672980 AGGAAAGCAAGGAAAGTGTGGGG - Intergenic
1043761523 8:84075199-84075221 AGAAAAACAAAGAAAGAGTGTGG - Intergenic
1044024471 8:87151496-87151518 AGAAAATTAAAGCAAGGAAGGGG + Intronic
1044535191 8:93349742-93349764 AAAAAATTCAGGGAAGGGTGAGG + Intergenic
1044693110 8:94897428-94897450 AGAAAATAAAGGGTAGGGGGCGG + Intronic
1046059315 8:109117601-109117623 AGAGAATAAAGGCAAGGGTGTGG + Intronic
1046150554 8:110218791-110218813 ACAAAGTCAAGCCAAGTGTGAGG - Intergenic
1046872727 8:119221487-119221509 GGAAAATGAAGGCAATGCTGAGG + Intronic
1047997424 8:130350013-130350035 AGACAATGAAGGCAAAGGTCTGG + Intronic
1048084934 8:131167241-131167263 AGAAAACCAAGGCAGAAGTGGGG - Intergenic
1049440870 8:142609122-142609144 AGAAATGCAAGGGAAGAGTGGGG + Intergenic
1049474714 8:142791412-142791434 AGCAAATGAAGGCAGGGGAGTGG - Intergenic
1050036862 9:1445370-1445392 AGAAAAGAAAGGAAAGGGGGAGG - Intergenic
1050073099 9:1837161-1837183 AGGAACTGAAGGCAAAGGTGAGG - Intergenic
1050598556 9:7228005-7228027 AAATAATCAAGGCAAGTGAGCGG + Intergenic
1051297266 9:15610188-15610210 AGACCATCAAGGGAGGGGTGGGG - Intronic
1051329064 9:16004503-16004525 ACAAAATCAATGCAAGGTTGAGG - Intronic
1052148480 9:25080184-25080206 AGAGATTGATGGCAAGGGTGAGG - Intergenic
1052898898 9:33773145-33773167 AGAAAATGGAGGCAAGAGTAAGG - Intronic
1053411619 9:37919577-37919599 AGAAACTCAAGGAGAGGGTGGGG + Exonic
1054453124 9:65413780-65413802 AGAAACTAAAGGCAAAGTTGGGG - Intergenic
1056228074 9:84516121-84516143 AGGAATTCAGGGCAAGGGTGGGG + Intergenic
1056238838 9:84623277-84623299 AGAGACTCAAGGAAAGGGGGCGG - Intergenic
1057342515 9:94215469-94215491 AGAAAATCAATCCAGGCGTGGGG - Intergenic
1057403348 9:94744033-94744055 TGAATAACAAGGCAATGGTGGGG + Intronic
1057945360 9:99323151-99323173 AAAAATTCAAGGCAGGGGAGGGG + Intergenic
1059583699 9:115581935-115581957 AGAAAATAAAGGGAAGGGGCTGG - Intergenic
1059985860 9:119819882-119819904 AGAAACTCAAGGGGAAGGTGGGG - Intergenic
1060314003 9:122491457-122491479 AGAAAAGCAAGGAAAGGGAAGGG + Intergenic
1061010909 9:127954135-127954157 ACAAACACAAGGCAGGGGTGAGG + Intronic
1061459927 9:130729374-130729396 AGAAGATGAGGGCATGGGTGGGG - Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1062205419 9:135334087-135334109 AGAAAATTAAGGCCAGAGAGAGG + Intergenic
1062645997 9:137548452-137548474 AGAAAATCCAGGGAAGGGCCGGG + Intronic
1186324468 X:8464145-8464167 AGATAATGATGGCAAAGGTGTGG - Intergenic
1186362842 X:8860885-8860907 AGACTATCAAGGACAGGGTGGGG + Intergenic
1187088696 X:16070076-16070098 AGCAAATGACGGCAAGGATGTGG - Intergenic
1187569528 X:20486900-20486922 AGAAAACCAAGGTGGGGGTGAGG + Intergenic
1188516518 X:30993415-30993437 AGAGAATCAAATCAAAGGTGAGG - Intergenic
1188727161 X:33599972-33599994 AGAAAACCCATGCAAGCGTGAGG + Intergenic
1189559322 X:42176289-42176311 AGACAATGAAGGCCAGAGTGGGG - Intergenic
1189605549 X:42674020-42674042 AGAACATAAAGGCAAGTATGAGG - Intergenic
1191108775 X:56789077-56789099 AGAAAGACAAGGCAAGGTGGGGG - Intergenic
1191854015 X:65608130-65608152 AGACAAACAAGGAAAGGGGGTGG + Intronic
1191894725 X:65980031-65980053 AGAAAACCATGCCAAGGGAGTGG + Intergenic
1192340095 X:70257260-70257282 AAAAAAGAAAGGCAAGGCTGGGG + Intergenic
1193179284 X:78434570-78434592 AGAAATTCAAGCTCAGGGTGGGG + Intergenic
1195246919 X:103003275-103003297 AGAAACTCAAGGAAAGGGAAGGG + Intergenic
1195852426 X:109297207-109297229 AGACAATGAAGGGAAGGGTAAGG + Intergenic
1196311451 X:114171443-114171465 AGAAGACCAAGAAAAGGGTGTGG - Intergenic
1197255200 X:124255673-124255695 ATAAAATCAAGGCATATGTGTGG - Intronic
1197342024 X:125286621-125286643 AGAAGAACAAACCAAGGGTGTGG + Intergenic
1197476764 X:126934297-126934319 AGCAAATAGAGGCTAGGGTGAGG - Intergenic
1198230920 X:134688623-134688645 AAAACATCAAGGAAAGGGTGGGG - Intronic
1198351792 X:135812377-135812399 AGCAAATGCTGGCAAGGGTGTGG + Intronic
1198355608 X:135846895-135846917 AGCAAATGCTGGCAAGGGTGTGG + Intronic
1198357519 X:135864174-135864196 AGCAAATGCTGGCAAGGGTGTGG + Intergenic
1198704013 X:139427698-139427720 AGCAGATCAAGGCAACGATGAGG - Intergenic
1198796110 X:140396942-140396964 AGCAAATGCAGGCGAGGGTGTGG + Intergenic
1199741337 X:150739232-150739254 AGGGAATCAAGGCAAGAGAGGGG - Intronic
1202068080 Y:20961450-20961472 AGAAAATTAAGGAAAGGGATGGG + Intergenic