ID: 955080887

View in Genome Browser
Species Human (GRCh38)
Location 3:55656970-55656992
Sequence ACTATTCCACAGCAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955080887 Original CRISPR ACTATTCCACAGCAGGATGG TGG Intronic
900076128 1:819216-819238 TCTCTTCCACTGCAGGCTGGGGG - Intergenic
901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG + Intronic
906446061 1:45899144-45899166 AGTCTTCCAAAGCAGGATGATGG + Intronic
909202694 1:72711541-72711563 TCTATTGCACAGCAGGATGACGG - Intergenic
913367280 1:118053937-118053959 AGTATTACACAACAGGATAGTGG - Intronic
916538049 1:165722936-165722958 ATCATCCCACAGCAAGATGGAGG + Intergenic
921814787 1:219551177-219551199 ACTATTCCAGAACAGGAGAGAGG + Intergenic
1063272590 10:4527731-4527753 CCTATTCCACAGCTGCATCGGGG + Intergenic
1067797616 10:49332130-49332152 ACTCTTCCACAGAAGGGAGGAGG + Intergenic
1068590978 10:58852792-58852814 CATTTTCCACAGCAGGCTGGAGG - Intergenic
1070641123 10:78170810-78170832 ACCATTTCTCAGCAGCATGGAGG - Intergenic
1075549667 10:123382949-123382971 TCTATTCAACAGGAGGATGAGGG + Intergenic
1077846628 11:6032404-6032426 TCTATTTCACAGCAGAGTGGAGG - Intergenic
1078549453 11:12270178-12270200 ACAAGTCCCCAGCAGGATGAGGG - Intergenic
1080423637 11:32136402-32136424 AATATTCCACAGATGGATGGTGG + Intergenic
1082042121 11:47694771-47694793 AGCATTCCACATCAGGATGGCGG + Intronic
1085402424 11:76242807-76242829 AATATTCCACAGCTGCAGGGAGG - Intergenic
1085571452 11:77561362-77561384 GGTACTCCACAGCGGGATGGAGG + Intronic
1087856290 11:103095446-103095468 ACTATTATACAGAAGGATGTAGG + Intergenic
1090404779 11:126470038-126470060 ACTACTGCACAGCAGGGCGGGGG - Intronic
1093073395 12:14731707-14731729 ACTCTTACACAGCAGGAATGAGG - Intergenic
1094438507 12:30448491-30448513 AATATTCCAAAGCAGGACTGTGG + Intergenic
1094497850 12:31000183-31000205 AATATTCCACAGAAGCAAGGGGG - Intergenic
1098787612 12:74779890-74779912 ACTATCCCAAATGAGGATGGGGG + Intergenic
1100407983 12:94287485-94287507 ACTACTCCATAGCAGGGTGCGGG - Intronic
1101711775 12:107274429-107274451 ACCATTCCACAGTATGATGGGGG - Intergenic
1106235094 13:27854484-27854506 ATTATTCCAAAGTAGGATCGCGG - Intergenic
1108796316 13:54035015-54035037 ATTATTGCCCAGCAGGTTGGTGG - Intergenic
1113074038 13:106450707-106450729 ACTAAGCCACAGCCCGATGGAGG + Intergenic
1115382131 14:32752316-32752338 AGTGTTCCAGAGCAGGAGGGTGG + Intronic
1119483746 14:74975287-74975309 ACTTGACCACAGCAGGATGGTGG + Intergenic
1119627613 14:76193716-76193738 ACTGTTAGACATCAGGATGGTGG - Intronic
1124058321 15:26263009-26263031 AGACTCCCACAGCAGGATGGAGG + Intergenic
1124186235 15:27531861-27531883 ACTTTTCCACTGCAGGAGGAGGG + Intronic
1124226888 15:27902729-27902751 ACTCTTCCTCTGCAGGCTGGGGG + Intronic
1124602799 15:31148997-31149019 ACTCTTCCACTGCAGCTTGGAGG - Intronic
1125082245 15:35688382-35688404 ACTATTCAAAATCAGTATGGTGG - Intergenic
1125152095 15:36544617-36544639 ACAATTCCCCAGCAGGATGAAGG + Intergenic
1126084677 15:45000639-45000661 CCTATGCCACCGCAGGATGTGGG + Intergenic
1127654912 15:61046682-61046704 AATATTACACAGCAGGATCCAGG + Intronic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1130254328 15:82318890-82318912 ACGATCACACAGCAGGTTGGGGG + Intergenic
1130600637 15:85271080-85271102 ACGATCACACAGCAGGTTGGGGG - Intergenic
1132410106 15:101571133-101571155 ATTATTCCAGATCAGGGTGGTGG + Intergenic
1133105477 16:3505634-3505656 ACTATTCCTCAGTAGGATGCTGG + Intronic
1136644004 16:31592892-31592914 TATATGCCACAGCAGGGTGGGGG - Intergenic
1137639465 16:50015744-50015766 ATGATTGCACAGCAGGATGAAGG - Intergenic
1138580326 16:57936920-57936942 ACTATCACAAAGCAGGATGAAGG + Intronic
1139031377 16:62885723-62885745 ACTATTCCAGAATAGCATGGGGG - Intergenic
1140455027 16:75099995-75100017 ATTCTTCCACAGCAGGAGGCAGG - Intronic
1141385675 16:83620442-83620464 AGTATTCCTAAGCAGCATGGGGG - Intronic
1145718650 17:27047922-27047944 AGGAGTCCTCAGCAGGATGGTGG - Intergenic
1146287491 17:31583839-31583861 AATATTCCACATCATGATTGTGG - Intergenic
1147610886 17:41801290-41801312 CCTATTCCACAGCAGGGAGGTGG - Intergenic
1148391594 17:47276630-47276652 ACTATCCCTCAGCAAGAGGGAGG + Intronic
1149838282 17:59934461-59934483 ACCAATCCACAGCACGATTGTGG - Exonic
1150874938 17:68960589-68960611 TCTATTCCACAACAAGAAGGAGG - Intergenic
1153150697 18:2089490-2089512 TGTATTCCACAGGATGATGGTGG - Intergenic
1155191017 18:23430561-23430583 ACTATTTCAAAGAATGATGGTGG + Intronic
1166382221 19:42361065-42361087 GCTAGGCCACACCAGGATGGAGG + Intronic
1166814085 19:45531721-45531743 CCTATTCCTCAGCAGTTTGGTGG + Intronic
929054114 2:37861522-37861544 ACTATTCCACAGGATGAGGCTGG - Intergenic
931711836 2:64994454-64994476 ACTATGCTACTGCAAGATGGTGG - Intronic
939406616 2:141766635-141766657 ACTAATGCACAATAGGATGGAGG + Intronic
940732958 2:157415694-157415716 CCTCTTCCACAGCACGATGAAGG + Exonic
941751910 2:169142961-169142983 ACTATCCCACTGCAGTGTGGTGG - Intronic
942370237 2:175276112-175276134 ACTATTCCAAATAAGAATGGGGG - Intergenic
942704050 2:178748001-178748023 GCATTTCCAAAGCAGGATGGTGG - Intronic
946467866 2:219928363-219928385 GATGTTCCTCAGCAGGATGGTGG - Intergenic
948469572 2:238168322-238168344 ACTCTTCCTCAGCAGGTAGGAGG - Intronic
1169217316 20:3801182-3801204 ACTTTTCCTCAGGAGGATGGGGG + Intronic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1175800135 20:61796763-61796785 AGCATTTCCCAGCAGGATGGGGG - Intronic
1176901060 21:14442775-14442797 ACTATGCCACAGCATGTTGATGG + Intergenic
1184256765 22:43291387-43291409 ACTATGGCACAGCACAATGGAGG - Intronic
1184256810 22:43291633-43291655 AGTATAGCACAGCACGATGGAGG - Intronic
950610930 3:14126026-14126048 ACTCTACCAAAGCAGGAGGGAGG - Intronic
950738428 3:15030479-15030501 CCTATCCCCCAGCAGGTTGGGGG - Intronic
951404160 3:22273763-22273785 ACTATTCCACAGGATGAGGAGGG + Intronic
952420310 3:33124565-33124587 ACCTTTCCATAGCAGGTTGGTGG + Exonic
953752410 3:45618798-45618820 ACAGTTCCACTGCAGGAGGGAGG + Intronic
955080887 3:55656970-55656992 ACTATTCCACAGCAGGATGGTGG + Intronic
955659629 3:61283583-61283605 ACAATTCCATAGCAAGATGTAGG - Intergenic
955678329 3:61473066-61473088 ACTTTTTTACAGAAGGATGGTGG + Intergenic
962745806 3:138396595-138396617 ACTTTCCCTCAGCAGGAAGGAGG + Intronic
964692105 3:159461394-159461416 TGTATTCCACAGCATGAGGGTGG - Intronic
967121492 3:186386366-186386388 ACCACTCCAGATCAGGATGGTGG - Intergenic
971447334 4:26765141-26765163 AGTAGGCGACAGCAGGATGGAGG + Intergenic
977291119 4:95165386-95165408 ACTTGCTCACAGCAGGATGGGGG + Exonic
977379212 4:96249182-96249204 TCTATTACACAGCAGGATGGTGG + Intergenic
991920571 5:71652739-71652761 ACTATTCCAGCGCAAGGTGGGGG + Exonic
992418385 5:76575471-76575493 AGTGGTCCACAGGAGGATGGTGG - Intronic
996709088 5:126526127-126526149 CCTCTTCTACAGCAGGAAGGAGG - Intergenic
999945670 5:156592606-156592628 ATTATTCCACAGAAGGAAAGGGG - Intronic
1001233197 5:170007701-170007723 TCTATTTCACTGCAGGCTGGTGG + Intronic
1002369587 5:178741059-178741081 ACCATTCCAAGGCATGATGGAGG - Intergenic
1002607298 5:180390777-180390799 ACATGTCCACAGCTGGATGGTGG + Intergenic
1003193390 6:3893618-3893640 AATATTCCACAGCACGAAAGCGG + Intergenic
1003976115 6:11346319-11346341 ACTATTCCATGTCATGATGGTGG + Intronic
1005430758 6:25754362-25754384 TCTATTAAACAGCAGGATGGTGG + Intergenic
1005614565 6:27560252-27560274 ATTATTCCCCAGCAGGACTGGGG - Intergenic
1005854532 6:29850734-29850756 ACTATTGCACTGCACGATGGTGG - Intergenic
1007241022 6:40425253-40425275 ACTTTTCTACACAAGGATGGGGG + Intronic
1010140088 6:72603515-72603537 ACTATGCCAAAACAGTATGGAGG - Intergenic
1011274856 6:85620689-85620711 ACTATTCCAGTGCAGGATACTGG + Intronic
1011458066 6:87573566-87573588 ACTGTTCCGCAGACGGATGGTGG + Intronic
1011807160 6:91085030-91085052 AGGATTTCACAGCAGGATCGTGG + Intergenic
1014644303 6:123954373-123954395 AGAAGTCCACAGTAGGATGGTGG + Intronic
1015036151 6:128657108-128657130 GCTAATCCATAGCAGCATGGGGG + Intergenic
1015741892 6:136464998-136465020 ATTATTCCACAGCAGCTTGATGG + Intronic
1016648018 6:146433045-146433067 ACTATCCTAAAGCAGGATGTGGG + Intronic
1018404387 6:163462783-163462805 ATTATTCCATACCAGGATTGTGG - Intronic
1023724030 7:43123752-43123774 ACTATTCCACAGCATCAGGCAGG - Intronic
1026442970 7:70459951-70459973 ACAATTCTACAGAAGGGTGGAGG + Intronic
1030211337 7:106998870-106998892 ACTATTCCACAGCACAAGAGGGG + Intergenic
1030383033 7:108834997-108835019 ACTATCACAGAGCAGCATGGGGG - Intergenic
1034311162 7:150089721-150089743 ACTATTTCTGATCAGGATGGGGG + Intergenic
1035751352 8:1998918-1998940 ACCACTGGACAGCAGGATGGGGG + Intronic
1035988468 8:4461329-4461351 TCTATTCCACAGCATACTGGAGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1048237361 8:132704008-132704030 GGTAGTCCTCAGCAGGATGGTGG + Intronic
1048603847 8:135947232-135947254 ACTGATCCAGAGTAGGATGGTGG - Intergenic
1050641461 9:7672244-7672266 AATGTTCAGCAGCAGGATGGTGG + Intergenic
1053129859 9:35608776-35608798 ACTATTCTCCAGGAGGCTGGTGG - Intronic
1059743925 9:117181985-117182007 ACCATTTCACAGCTGGAAGGTGG - Intronic
1062658714 9:137617488-137617510 AATATTCCAAATCAGGATGTGGG + Intronic
1198524272 X:137484630-137484652 TCTATTCCCCAGCAGGATATGGG - Intergenic
1199967922 X:152835071-152835093 AATGTTCCCCAGCAGGAAGGAGG + Intronic
1201691714 Y:16774674-16774696 AGTATTCCCCATCAGCATGGTGG - Intergenic