ID: 955084454

View in Genome Browser
Species Human (GRCh38)
Location 3:55689052-55689074
Sequence CACACTGGGGTGTCTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955084449_955084454 -8 Left 955084449 3:55689037-55689059 CCATATTTTAAAAGACACACTGG 0: 1
1: 0
2: 1
3: 49
4: 305
Right 955084454 3:55689052-55689074 CACACTGGGGTGTCTCTCAAGGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955084454 Original CRISPR CACACTGGGGTGTCTCTCAA GGG Intronic
902709309 1:18227736-18227758 CACACTGTGGTTTCTGTGAATGG - Intronic
903213911 1:21832830-21832852 CACACTGGAGTCTCCCTCAAGGG + Intronic
908070423 1:60454416-60454438 CATACTGGGGAGCCTCTCCAGGG - Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908626268 1:66047162-66047184 TATGCTGGGCTGTCTCTCAAAGG - Intronic
909673201 1:78211740-78211762 CATCCTGGGGTGCCTCTCAGAGG + Intergenic
913205098 1:116531656-116531678 CCCACAGAGGTGTCACTCAAAGG - Intronic
919086710 1:192929210-192929232 CACACTGGTTTGTTTCTCTAAGG - Intergenic
919139241 1:193549847-193549869 CACACTCTGGGGCCTCTCAAAGG - Intergenic
921125896 1:212177722-212177744 AAGACTGGGGCCTCTCTCAAAGG - Intergenic
921254724 1:213329223-213329245 CTCAGTGAGGTGTCTCCCAACGG + Intergenic
921913599 1:220579665-220579687 AACACTGGGGTGTGTGTGAATGG + Intronic
922776823 1:228218557-228218579 CAGACTGGAGTGTCTCTGACAGG + Intronic
923379876 1:233406296-233406318 GACTGTGGGGTGTCTCTGAATGG + Intergenic
1062949777 10:1489831-1489853 CACTCTTGGGTGTCTCTCTTGGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065452738 10:25875619-25875641 CACCCTGAGGTGTTTCTCCAGGG - Intergenic
1066308226 10:34168534-34168556 GACACTGGTGGGTCTCTCTAGGG + Intronic
1070487432 10:76944026-76944048 TACACGGAGGTGTCACTCAATGG + Intronic
1072278624 10:93846021-93846043 CCCACTGGGGTCTCCTTCAATGG + Intergenic
1072484027 10:95837371-95837393 CACTCTGGGAGGTTTCTCAAGGG + Intronic
1072563975 10:96602303-96602325 CACCCTGGGGGGTCTCTCGAGGG + Exonic
1075939665 10:126379524-126379546 CACACTGGGGCGCCTGTCAGGGG + Intronic
1076344853 10:129773257-129773279 CCTACTGGGGTGTCCCTCCAAGG + Intergenic
1079408519 11:20165422-20165444 CACACTGGGCTGTCACTCCTGGG + Intergenic
1082098049 11:48147168-48147190 CACACTGTGGCGTCTATCAGTGG - Intronic
1084723343 11:70923976-70923998 CTCACTGCAGTGTCTCACAAGGG - Intronic
1088674893 11:112182684-112182706 CACACTGGGGGGCCTGTCATGGG + Intronic
1088865254 11:113841609-113841631 CACATTTGTGTGTATCTCAAAGG - Intronic
1089290174 11:117432975-117432997 CTCACTGTGGCTTCTCTCAAGGG - Intronic
1090382723 11:126338219-126338241 CAGTTTGGGGTATCTCTCAAGGG + Intronic
1093301178 12:17457989-17458011 CACATAGTGGTGTCTCTCATGGG + Intergenic
1094835340 12:34319554-34319576 CACTTTGGGGTGCCCCTCAATGG + Intergenic
1095616216 12:44192495-44192517 CAAACTGGGGTGACACTGAATGG + Intronic
1098221088 12:68270584-68270606 CACACAGGGCTGTCTCTATAGGG + Intergenic
1103360779 12:120352302-120352324 CAGGCTCGGGTGTCTCTAAAAGG + Intronic
1104795458 12:131514046-131514068 CACACAGGTGTGTCTCTCTGGGG + Intergenic
1112671939 13:101650798-101650820 CACACTGGGGTCTGTCAAAAGGG - Intronic
1114181852 14:20374387-20374409 CCCACTGGGGGGTCTCTGGAAGG - Intronic
1117646033 14:57853860-57853882 GACACCGGGGAGTCTCTCATGGG - Intronic
1119046843 14:71325976-71325998 CAAACTCGGGGGTCACTCAAAGG + Intronic
1119380275 14:74224071-74224093 CCCACTGGGTTGTCACTCATGGG + Intergenic
1122141303 14:99664477-99664499 CACACTCGGGTGTCACTCAGAGG - Intronic
1122338261 14:101007741-101007763 CAGAGTGGGGTGTGTCACAAAGG + Intergenic
1122725043 14:103744966-103744988 CACCTTGGGGAGTTTCTCAAAGG + Intronic
1122742980 14:103882479-103882501 CAAAGTGGGGTGGCTCTCCAGGG + Intergenic
1202857374 14_GL000225v1_random:59507-59529 CACTCTGTGGAGTCTCTCACCGG - Intergenic
1123797387 15:23785727-23785749 CACACTGGGGGTTCACTTAAAGG - Intergenic
1124023327 15:25943308-25943330 CACACTGCAGTCTCTCTTAAGGG - Intergenic
1125803749 15:42474085-42474107 CTCACTTGGGGGTCTCTCATTGG - Intronic
1127978813 15:64018837-64018859 CATGCTAGGGTGTCTCTCAGAGG - Intronic
1130299471 15:82668788-82668810 CACACTGGAGTGTATCTCAGAGG - Intronic
1131537028 15:93245971-93245993 CACTCTGGGAGGTCTCTCAGTGG + Intergenic
1131823882 15:96300887-96300909 CACACTGGTCTGTCACTCACAGG - Intergenic
1131839492 15:96420864-96420886 CACACTGTGGTTTCTCTTTAGGG - Intergenic
1132988037 16:2778011-2778033 CAGCCTGGGGTGTCTCTGCAAGG - Intergenic
1133544468 16:6791789-6791811 CACACAGGGATGCCACTCAAAGG - Intronic
1136092171 16:27928397-27928419 CACACAGGAGTGTCGCTCAGAGG - Intronic
1138474938 16:57265044-57265066 CACACTGGGGTGAAGCTCCAGGG + Intronic
1142737263 17:1908755-1908777 CGCCCTGGGGTGTCTCACAGAGG + Intergenic
1149331444 17:55586966-55586988 AGCACTGGGGTGTCTCACACTGG + Intergenic
1150304378 17:64071818-64071840 CACACTGGGGGGACACTGAAGGG + Intronic
1151218467 17:72593410-72593432 CACACTGTGGTGTTTCTACAAGG + Intergenic
1153250470 18:3116739-3116761 CACTCTGAGGTGCCTCTCAAAGG + Intronic
1154197724 18:12278772-12278794 CACACTGTGGTGTCTTTCTGTGG - Intergenic
1156203747 18:34863469-34863491 CCCATTGAGGTGTCTCTCAGAGG - Intronic
1156393929 18:36680615-36680637 CACCCTGTGGTTTCTCTCCAAGG + Intronic
1156573405 18:38283950-38283972 CAGTCTGGCCTGTCTCTCAATGG + Intergenic
1156850667 18:41722078-41722100 TACACTGAAGTGTCTCTAAAAGG + Intergenic
1158945634 18:62444803-62444825 CTCACTTGGGTCTCTCCCAAGGG + Intergenic
1163843628 19:19626886-19626908 CACACTGCGGTGCCGCTCCACGG + Exonic
1165705990 19:37976535-37976557 AGCTCTGGGGTGTCTCTCAGTGG + Intronic
1165866484 19:38942632-38942654 CACACTGGAGTGGGTCACAAGGG + Exonic
1166049327 19:40248656-40248678 CAAGCTGGGGTGTCTGTGAAAGG + Intronic
1168667031 19:58211772-58211794 CACACTGGGCATTCCCTCAAGGG + Intronic
925094491 2:1185220-1185242 CCCACTGCTGTGGCTCTCAAAGG + Intronic
925192304 2:1894310-1894332 CCCACGGTGGTCTCTCTCAAAGG - Intronic
925217669 2:2111059-2111081 CCCACTGCTGTGTCCCTCAAAGG - Intronic
925608693 2:5684879-5684901 CTCACAGGTGTGTCTCTCTAAGG + Intergenic
927465406 2:23332710-23332732 CTCACTGTGGGGTCTCTCAAAGG - Intergenic
928965135 2:36968193-36968215 AAGACTGGGCTGTATCTCAAAGG - Intergenic
929961258 2:46497942-46497964 CTCCATGGGGTGCCTCTCAAGGG - Intronic
931370613 2:61659126-61659148 CACACAGAGGTGTCCTTCAAAGG - Intergenic
934120504 2:88833352-88833374 CTCTCTGGGGTGACACTCAAAGG + Intergenic
935736609 2:106111440-106111462 CACAGTGGGATGACTCTCCAAGG - Intronic
936817972 2:116484079-116484101 CACACTGGGGAGACTCTCTGGGG - Intergenic
936832445 2:116664240-116664262 CACACTCTGGTGCCTGTCAAGGG + Intergenic
937265363 2:120611841-120611863 GAGATAGGGGTGTCTCTCAAGGG + Intergenic
937890104 2:126931943-126931965 TGCACTGGGGAGTCTCTCCAGGG + Intergenic
938813226 2:134872794-134872816 CACACAGGGGATTCTCTCCAGGG + Intronic
940424057 2:153510917-153510939 CACTCTGTGGTATCTCGCAATGG + Intergenic
944260317 2:197668947-197668969 CATACTGGGGAGTCTCTCTCAGG + Intronic
945431339 2:209769684-209769706 CACACACTGGTGTCTTTCAAAGG - Intergenic
945890333 2:215424130-215424152 CACACTGGTGAGTGTCCCAAGGG - Exonic
946165780 2:217862996-217863018 CACACTGAGGGGTCTCTCCAGGG + Intronic
946197610 2:218044602-218044624 CACACTGGGGGGTTTATCAGAGG - Intronic
947707211 2:232285884-232285906 TACACTGGGGTTTCTCTACAGGG + Intronic
948012110 2:234657085-234657107 TACACTGGGTTGTGTCTAAAAGG - Intergenic
1168759903 20:343046-343068 CCCACTGGAGTGTCTCTGATTGG - Intergenic
1170528602 20:17266747-17266769 CACACTGGGGTAACTCTGAAGGG - Intronic
1170604644 20:17866415-17866437 CACACTGAGGTGTCTCCTAGGGG + Intergenic
1173883772 20:46439097-46439119 CACACTGGGGTGGGGGTCAAAGG + Intergenic
1174986406 20:55458566-55458588 CCAACTGAGCTGTCTCTCAAAGG - Intergenic
1175880373 20:62254528-62254550 GACACTGGAGAGTCTCTCAGGGG + Intronic
1176552792 21:8236259-8236281 CACACCGGGGTGGCTCTGGAAGG - Intergenic
1176571690 21:8418662-8418684 CACACCGGGGTGGCTCTGGAAGG - Intergenic
1176579601 21:8463224-8463246 CACACCGGGGTGGCTCTGGAAGG - Intergenic
1179238967 21:39572227-39572249 CTCAGTGGGATGGCTCTCAAGGG - Intronic
1182083134 22:27543312-27543334 CTCATTGGGGTGTCTCTCTTAGG + Intergenic
1182408097 22:30155603-30155625 CACAATGTGGTTTCTCTCAGTGG + Intronic
1182679419 22:32067137-32067159 CACCCTGGGGTGACCCTGAAGGG - Intronic
1184764081 22:46562455-46562477 GACACGGGGATGTCTCGCAATGG - Intergenic
1203257769 22_KI270733v1_random:152659-152681 CACACCGGGGTGGCTCTGGAAGG - Intergenic
955084454 3:55689052-55689074 CACACTGGGGTGTCTCTCAAGGG + Intronic
959270306 3:104199481-104199503 CACACTGGGGAGACGCTCGAGGG - Intergenic
966861856 3:184234939-184234961 CTCTCTGGGGTGTGTCTCAGAGG + Intronic
967922141 3:194621485-194621507 CCCACCGGGGTGGCTCTCCAGGG - Intronic
969191661 4:5526270-5526292 CACACTGGGGTTTGGGTCAAAGG - Exonic
969284013 4:6191197-6191219 CACACTGGGGTCTCACTCACTGG - Intronic
969991157 4:11264190-11264212 TACTCTGGGGTGTCTGGCAACGG - Intergenic
972627048 4:40809535-40809557 TACAGTGAGGTGTCTCTCACTGG + Exonic
973193313 4:47411344-47411366 AAAACTTGGATGTCTCTCAAGGG + Intronic
980133362 4:128836948-128836970 TAAACTTTGGTGTCTCTCAAAGG + Intronic
989589788 5:43102713-43102735 CTCACTGGGGTGTCTCTGCATGG + Intronic
990664392 5:58055266-58055288 AACACTAGGGTGGCTCCCAAGGG - Intergenic
1003224717 6:4192901-4192923 CTCCCTGGGGTGTCACCCAAGGG + Intergenic
1006745144 6:36336477-36336499 CTCAACGGGGTGTTTCTCAAAGG - Intronic
1009996535 6:70901479-70901501 CACATTGGTGTGTGTGTCAAAGG + Intronic
1010515167 6:76763463-76763485 CACTTTGGGGTGTCTCACTAGGG + Intergenic
1011042065 6:83040456-83040478 CATACTGGGGTCTTTCTCTATGG + Intronic
1011723089 6:90179180-90179202 CACACTAGAGTGTCTCCCAAGGG - Intronic
1014150060 6:118044269-118044291 CACACTGGAGTTTCATTCAAGGG + Intronic
1016829191 6:148416874-148416896 CACAATGAGGTCTCCCTCAATGG - Intronic
1020004639 7:4775808-4775830 CACACGGGGGTGGGTCTCACAGG + Intronic
1020669499 7:11089378-11089400 CACACCGTGGTTTCTCTAAAAGG + Intronic
1021421182 7:20446332-20446354 CAGAAAGGGGTGTCTCTCTATGG - Intergenic
1024013765 7:45293064-45293086 CACACTGCAGTGTGTCTCAGTGG + Intergenic
1026368009 7:69668985-69669007 CCCCCTTGTGTGTCTCTCAATGG - Intronic
1026922866 7:74169416-74169438 AGCCCTGGGGTGGCTCTCAAAGG - Intergenic
1028563466 7:92201695-92201717 CACACTCCGGGGTCTCTCAGGGG - Intronic
1034020826 7:147640794-147640816 CACACAGGGTTTTCTCTCATTGG - Intronic
1037739112 8:21591086-21591108 TAGACTGGGGTGACTCTCACAGG + Intergenic
1039715182 8:40100673-40100695 TACACTGCAGTGCCTCTCAAGGG - Intergenic
1039800102 8:40946656-40946678 TACAGTTGAGTGTCTCTCAAGGG + Intergenic
1039816336 8:41097874-41097896 CTCACTGGGATGTTTCTCACTGG - Intergenic
1040391715 8:46955692-46955714 CATGCTGGGGTGTCTCTCAAAGG + Intergenic
1044824270 8:96181416-96181438 CACACTGGGGTTTCTCATAGTGG + Intergenic
1045290018 8:100825063-100825085 CAGACTGGGGTTTCCCTCTAAGG + Intergenic
1046463633 8:114573306-114573328 CACACTGGTGAGTCTTTCTAAGG - Intergenic
1048453343 8:134553960-134553982 CACACTGTTGTTTCTCTCATGGG + Intronic
1052827489 9:33187565-33187587 CACACTGAGTCGGCTCTCAAAGG + Intergenic
1053354040 9:37431576-37431598 CACACTGTGGTGCTTCTCAGTGG + Intronic
1054975428 9:71138228-71138250 CACACTGGGGTCCATATCAAAGG + Intronic
1056395911 9:86180879-86180901 CTCACAGAGGTGTCTCCCAAGGG + Intergenic
1056556560 9:87694677-87694699 GACAGTGGGGTCTCTGTCAATGG + Intronic
1059975602 9:119713534-119713556 GACACTGGGGTTTACCTCAAGGG - Intergenic
1061324396 9:129854432-129854454 CAGACTTGGGTGACCCTCAAAGG + Intronic
1203473962 Un_GL000220v1:134682-134704 CACACCGGGGTGGCTCTGGAAGG - Intergenic
1191713753 X:64179649-64179671 CACACTGGGGTATATCTAAGAGG + Intergenic
1197713062 X:129686151-129686173 CCCTCTGGAGTGTCTCTCCAAGG - Intergenic