ID: 955085228

View in Genome Browser
Species Human (GRCh38)
Location 3:55696322-55696344
Sequence CAACAATGACTTATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955085228_955085241 30 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085241 3:55696375-55696397 GGCTGGAAGATTCACAGAAAGGG 0: 1
1: 0
2: 0
3: 22
4: 251
955085228_955085240 29 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085240 3:55696374-55696396 GGGCTGGAAGATTCACAGAAAGG 0: 1
1: 0
2: 1
3: 29
4: 208
955085228_955085232 -1 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085232 3:55696344-55696366 GGTCAAGCCTTTAAGGCCACAGG 0: 1
1: 0
2: 0
3: 2
4: 71
955085228_955085237 13 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085237 3:55696358-55696380 GGCCACAGGAAGGCCAGGGCTGG 0: 1
1: 0
2: 14
3: 148
4: 872
955085228_955085231 -8 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085231 3:55696337-55696359 CATTGTTGGTCAAGCCTTTAAGG 0: 1
1: 1
2: 0
3: 4
4: 98
955085228_955085233 3 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085233 3:55696348-55696370 AAGCCTTTAAGGCCACAGGAAGG 0: 1
1: 1
2: 0
3: 10
4: 246
955085228_955085235 8 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085235 3:55696353-55696375 TTTAAGGCCACAGGAAGGCCAGG 0: 1
1: 0
2: 4
3: 23
4: 238
955085228_955085236 9 Left 955085228 3:55696322-55696344 CCTTCTTCCATAAGTCATTGTTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 955085236 3:55696354-55696376 TTAAGGCCACAGGAAGGCCAGGG 0: 1
1: 0
2: 3
3: 61
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955085228 Original CRISPR CAACAATGACTTATGGAAGA AGG (reversed) Intronic
900825262 1:4921131-4921153 GACTAATGACTTTTGGAAGATGG - Intergenic
901941821 1:12668061-12668083 CACCTATGACTGATGGAGGAGGG + Intergenic
905285711 1:36878985-36879007 CAAGGATGACTTAAGGATGAAGG + Intronic
907089415 1:51710496-51710518 AAACAATGCCTGATGGAAGGTGG - Intronic
907806680 1:57827527-57827549 GAAAAATAAATTATGGAAGATGG + Intronic
909126459 1:71677212-71677234 CATCAATGAATCATGGAGGATGG - Intronic
913054727 1:115147806-115147828 GAGAAATTACTTATGGAAGATGG + Intergenic
917604529 1:176613203-176613225 CCACAATGACTTGTGAAAGAAGG - Intronic
919179586 1:194062990-194063012 CGAAACTGACTTACGGAAGAAGG + Intergenic
919488118 1:198169666-198169688 GAACAGTGACATATGGAAAATGG - Intronic
919598768 1:199596876-199596898 CCACAATAACTAATGGATGATGG + Intergenic
920916605 1:210262646-210262668 AAAAAATGACTGATGGAAGGAGG - Intergenic
921927891 1:220727864-220727886 CATGAATGAATTATGGAAGTGGG + Intergenic
924097359 1:240566359-240566381 GAACAATGATCTCTGGAAGATGG + Intronic
1064163607 10:12967107-12967129 CAAAACTGATTTATGGGAGAAGG - Intronic
1064810559 10:19193136-19193158 CCACAATGAGTTCTGAAAGAAGG + Intronic
1065056817 10:21853199-21853221 CCAGAATGACTTCTGGAACATGG - Intronic
1065876995 10:30006136-30006158 CAATAATGACTTCTGGAATTGGG - Intergenic
1066241439 10:33539656-33539678 CAAAACTGACTTCAGGAAGAAGG + Intergenic
1067479108 10:46584012-46584034 CAACAGTGACTCAGGGAGGAGGG + Intronic
1067615631 10:47757789-47757811 CAACAGTGACTCAGGGAGGAGGG - Intergenic
1074543079 10:114382350-114382372 CAGCCTTGACTTAAGGAAGAAGG + Intronic
1076757578 10:132580771-132580793 CAACAATGACTGATGGACAGAGG - Intronic
1079475338 11:20823916-20823938 CAACAATGATTTAAACAAGATGG + Intronic
1079608986 11:22406757-22406779 CAAAAATGACTTGAGGAAGTAGG - Intergenic
1080135668 11:28851313-28851335 CAACAAGGACTCAGGGAAGATGG - Intergenic
1080160398 11:29168096-29168118 CAAGAATGACATAGGAAAGATGG - Intergenic
1080380396 11:31764838-31764860 CAACAAACACTTCTGGTAGAGGG + Intronic
1081243168 11:40731415-40731437 GAACATTTACTTATGGCAGAAGG - Intronic
1081857495 11:46312872-46312894 GAACAATGAACTGTGGAAGAAGG + Exonic
1083049000 11:59760295-59760317 AAAAAATGAGTTTTGGAAGATGG - Intronic
1083591894 11:63900437-63900459 CATAAATGAAATATGGAAGAAGG - Intronic
1087567273 11:99877390-99877412 CAACAGTGACATATGCAAGTAGG + Intronic
1088154997 11:106791705-106791727 CAAATTTGACTTCTGGAAGAGGG - Intronic
1088308182 11:108432707-108432729 CTACAATTGCCTATGGAAGATGG + Intronic
1092736780 12:11590247-11590269 CAGGAATGAGCTATGGAAGATGG + Intergenic
1093147177 12:15580750-15580772 CAGAAATGACTTCTGGAAGATGG + Exonic
1093670395 12:21867564-21867586 CAGGAATGACATTTGGAAGAAGG + Intronic
1095158482 12:38887369-38887391 TTACAATGACTTACGTAAGATGG - Intronic
1097809055 12:63998859-63998881 CAATAAGTACTTATTGAAGAAGG - Intronic
1098442826 12:70536084-70536106 CAAGGATGACTTCTGGAAAATGG - Exonic
1103136563 12:118512875-118512897 AAACAATGATTGATGGAAGAGGG - Intergenic
1103137450 12:118519755-118519777 CACCAGTGACTTTTGGAAGCTGG + Intergenic
1106401516 13:29435791-29435813 AAACAAGCACTTATGGAGGAAGG + Intronic
1106606394 13:31233383-31233405 TAACAGTGACTTAAAGAAGATGG + Intronic
1106887816 13:34208829-34208851 CAACGATGACTTAAACAAGATGG + Intergenic
1106936037 13:34721288-34721310 CAAGAATTAATTATGAAAGAAGG + Intergenic
1108536280 13:51383315-51383337 CAAGAATGACTTACCTAAGAGGG + Exonic
1110096298 13:71526536-71526558 CAAAAATGACTTTTGGAAGTAGG - Intronic
1111564718 13:89999749-89999771 CAACAAAGGATTTTGGAAGAAGG + Intergenic
1112682709 13:101785734-101785756 CAAAAATGATTTATGAAAGGAGG - Intronic
1114678988 14:24467636-24467658 CACCCAGGACTTTTGGAAGATGG + Intergenic
1120393456 14:83938012-83938034 CAACAAATACTTAAGGAAAATGG + Intergenic
1120763357 14:88305929-88305951 AACCAATAACTGATGGAAGATGG - Intronic
1124562529 15:30788436-30788458 CAACGATGACAAATGGAAGGGGG - Intergenic
1124871673 15:33549647-33549669 CAACAATGAATTATGTTAAAAGG - Intronic
1125186838 15:36940568-36940590 GAACAATGACTTCTGGGAGCAGG + Intronic
1126026647 15:44452987-44453009 CAATAATGTCTTTTGGTAGACGG + Intronic
1126319056 15:47402470-47402492 CAACAGTGATTTATGTAATAGGG + Intronic
1126493970 15:49269976-49269998 CAACTATTCCTTATGGAATATGG + Intronic
1127912403 15:63428225-63428247 CACCAATGACTGATGGAAGTTGG - Intergenic
1128118086 15:65124950-65124972 CAACAGAGACTTGTGGAAGATGG - Intronic
1130161376 15:81404016-81404038 CAAAAATGACTCATTGAAGCAGG + Intergenic
1130759223 15:86800491-86800513 CCAAATAGACTTATGGAAGAAGG - Intronic
1131854700 15:96581249-96581271 CCACAAGGACTTATTAAAGAGGG - Intergenic
1135880870 16:26255014-26255036 CAAGAGTGAATTTTGGAAGAAGG + Intergenic
1137482773 16:48866021-48866043 CCACAATGACTTATGGGATTGGG + Intergenic
1139014924 16:62678216-62678238 CAACCATGTCATGTGGAAGATGG - Intergenic
1142952497 17:3495070-3495092 CAATAATGACATAGTGAAGAAGG + Intronic
1146987321 17:37232612-37232634 TAGCAGTGACTTATGGAACATGG - Intronic
1150934606 17:69622016-69622038 CTAGAATCACTTATTGAAGAGGG + Intergenic
1151228448 17:72664330-72664352 GAGCAATGAGGTATGGAAGAGGG - Intronic
1153762308 18:8343439-8343461 CATCTATGACTTCTGGAGGATGG + Exonic
1155695061 18:28675276-28675298 GAACAATGAATTATGGCAGCTGG + Intergenic
1156503297 18:37573270-37573292 CAGAAATGATTTATGGAAAATGG - Intergenic
1158696190 18:59706303-59706325 CAAAAATGATTGATGGAAGAGGG - Intergenic
1158761874 18:60399834-60399856 CAACAATTACTAATGAAAAAAGG + Intergenic
1159694954 18:71545406-71545428 CATTCATGACTTATGGTAGATGG - Intergenic
1160282892 18:77509621-77509643 CCACAATACCTTGTGGAAGAAGG - Intergenic
1165684555 19:37807972-37807994 CAACAATGAACAATGGGAGAAGG + Intronic
926844107 2:17115024-17115046 AAACACTGAATTATTGAAGAAGG - Intergenic
927158926 2:20240492-20240514 CAACAATGGCTTTAAGAAGAAGG - Intergenic
930764459 2:55070613-55070635 CAAAAATGCCTTTGGGAAGAGGG + Intronic
933057913 2:77696626-77696648 CAAGAATGATTTTTTGAAGAAGG - Intergenic
934952524 2:98587317-98587339 CAACAAATACATATGTAAGATGG - Intronic
935189765 2:100767551-100767573 CAACAATTACAGAGGGAAGAAGG + Intergenic
937571390 2:123367207-123367229 CCAGAATGAATTAGGGAAGAGGG - Intergenic
937689403 2:124737684-124737706 CAAAAATAACTTTTGGAGGATGG + Intronic
937842655 2:126539203-126539225 AAAAAACTACTTATGGAAGAGGG + Intergenic
938376019 2:130807294-130807316 CAACAATAAATTATGCAAGATGG + Intergenic
939830198 2:147062482-147062504 CAAGAAAGGCTTCTGGAAGAAGG + Intergenic
941644600 2:168026487-168026509 CAATAATGATTTATGGAGAATGG - Intronic
1168742218 20:201472-201494 CAAAAATTATTTATGGAAAAAGG - Intergenic
1169344472 20:4819551-4819573 AACCAATGACTGATGGGAGAAGG - Intronic
1169573419 20:6931034-6931056 CAGCAATGACTTACAGAAGTTGG + Intergenic
1169593215 20:7168295-7168317 GAGCAATGAAATATGGAAGAAGG + Intergenic
1170119409 20:12895459-12895481 AAACAATGACTGATGGGAGCTGG + Intergenic
1170603311 20:17858395-17858417 CAACAATGACTTAAGCAAGTTGG + Intergenic
1170623348 20:18011994-18012016 CACCAAGGACTTAAAGAAGAAGG + Intronic
1173555234 20:43961162-43961184 CAGCAATGGCTTCTGGAAGGAGG + Intronic
1177269736 21:18831597-18831619 CAACAATGACTTGGGGAACTGGG - Intergenic
1177375855 21:20270228-20270250 CAACACTGACTTCTAGAATAGGG - Intergenic
1177483694 21:21727451-21727473 GAACAATGATTTATGGAATCAGG - Intergenic
1177495725 21:21888648-21888670 CAACCTTGACTTATTTAAGATGG + Intergenic
1177903797 21:26950608-26950630 CAATACAGACTTCTGGAAGATGG - Intronic
1177910221 21:27021925-27021947 CAACAATCAGTTCTGGCAGAAGG - Intergenic
1179490199 21:41736301-41736323 CAACAATTAGTTATGAAAGAAGG + Intergenic
950979004 3:17281179-17281201 CAACCAAGACTTCTGAAAGATGG + Intronic
951627055 3:24677142-24677164 CAAAAATGACCTATGCAAAAAGG - Intergenic
952708829 3:36408267-36408289 CAACAAAGACTTAAGGGAGCAGG - Intronic
955085228 3:55696322-55696344 CAACAATGACTTATGGAAGAAGG - Intronic
956234145 3:67048905-67048927 CAAAAATGACTTCAGAAAGAGGG + Intergenic
956782849 3:72617997-72618019 ACACAATGACTGATAGAAGAAGG - Intergenic
957784280 3:84861033-84861055 CAACATTCTCTTAGGGAAGAAGG + Intergenic
958804848 3:98797898-98797920 AAACAAAGGTTTATGGAAGAGGG + Exonic
959846020 3:111034822-111034844 CTACCATGCTTTATGGAAGAGGG + Intergenic
961427503 3:126859586-126859608 TCACGATGACTTATGTAAGAGGG - Intronic
962952558 3:140232818-140232840 TAACAAAGAATTATGGAAGTAGG - Intronic
963749183 3:149157647-149157669 CAACAAATGCTTGTGGAAGAAGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966185376 3:177222144-177222166 CTGAAATGAGTTATGGAAGAAGG + Intergenic
967539931 3:190655609-190655631 TAAGAAAGACTTATTGAAGAAGG + Intronic
969647093 4:8437543-8437565 AAACAAAGACTTAAGGAAAAAGG + Intronic
972108831 4:35528714-35528736 TAACAATGAATTATTTAAGAGGG - Intergenic
974465933 4:62256018-62256040 CAATCATGCCTTAAGGAAGAGGG - Intergenic
976621820 4:87136128-87136150 TAACAATGACTTTTGGTAAAGGG + Exonic
978296763 4:107214490-107214512 CAACAATGACTTTTGGATGAAGG + Intronic
981317960 4:143359935-143359957 TAACAGTGACTCATGGAAAAAGG - Intronic
981362617 4:143865073-143865095 CCAGAATTACTCATGGAAGATGG + Intergenic
981817871 4:148851736-148851758 AAACAATTACTTATGGTATAGGG + Intergenic
982466620 4:155740573-155740595 CAACAAAGACTTCTGGGTGAAGG - Intergenic
982742285 4:159070064-159070086 CAACAATTACTCATGACAGAAGG + Intergenic
984660372 4:182367901-182367923 AAGAAATGACTTATGAAAGATGG - Intronic
986783021 5:11084523-11084545 CAACAATGACATATTGCAAAAGG + Intronic
986783916 5:11093029-11093051 CAACATGGACTTAGTGAAGAAGG - Intronic
987346547 5:16984056-16984078 CAACCTTGACTTACTGAAGAAGG + Intergenic
987444755 5:18004008-18004030 CATCCATGACTCAAGGAAGAAGG + Intergenic
987624724 5:20383929-20383951 CAAGAATGACTTATGAGAAAAGG + Intronic
990283682 5:54278272-54278294 CAACCATGCCTGATGGTAGAAGG + Intronic
993554220 5:89315548-89315570 GAAAAATGACTTTTGGCAGAAGG - Intergenic
994005478 5:94832230-94832252 GAACAATGGCTTATGCAAGGAGG - Intronic
998636945 5:143966063-143966085 CAAAAATGGCTAATGGAAAATGG - Intergenic
1000464003 5:161553063-161553085 CATTAAAGACTAATGGAAGATGG - Intronic
1002409975 5:179066294-179066316 CAGCAATGCCGTAAGGAAGAGGG - Intronic
1002879839 6:1241783-1241805 CAACAATGACTTTTTGGAGGAGG - Intergenic
1005416475 6:25605242-25605264 CATGCATGACATATGGAAGATGG + Intronic
1006497099 6:34431641-34431663 CAACAATGACTAAGGAAGGAAGG + Intergenic
1010318718 6:74481831-74481853 CAAAAATGACTTTTGTAAAAAGG + Intergenic
1010478784 6:76323612-76323634 CAACAATAACTAATAGTAGAAGG + Intergenic
1012817846 6:104046867-104046889 AATCAATTATTTATGGAAGAGGG + Intergenic
1015021485 6:128480947-128480969 AGAGAATGACTTAAGGAAGAGGG - Intronic
1015826507 6:137318185-137318207 CAACAATAATTTTTAGAAGAGGG + Intergenic
1018205711 6:161435898-161435920 CAGCAATGACTTGGGGAGGAGGG + Intronic
1018499086 6:164383260-164383282 CAGTAATCACCTATGGAAGAAGG - Intergenic
1019954172 7:4399843-4399865 AAACAATGACTGCTGGAAGTTGG - Intergenic
1020476759 7:8604527-8604549 TAAAATTGACTTATGCAAGAGGG + Intronic
1020648074 7:10840585-10840607 CCACCATGAGTTATGGAATAAGG + Intergenic
1022170269 7:27821326-27821348 CAACAATTACTTTTCTAAGATGG - Intronic
1026235807 7:68526294-68526316 CTCCAATAACTTATGGAGGAAGG + Intergenic
1027622233 7:80503592-80503614 CAACATTGACTTTTGGACAATGG + Intronic
1028022558 7:85794331-85794353 GAAGAATGACTTATAGATGAAGG + Intergenic
1028553665 7:92099788-92099810 GAAGAATGACTTAAGGAACATGG + Exonic
1029951110 7:104586911-104586933 CAACAGGGACATTTGGAAGAAGG - Intronic
1032577118 7:133066839-133066861 CAACAATTACTTATAGACAACGG + Intronic
1034376619 7:150650488-150650510 CCCCAATAACTTATGGAAAAAGG - Intergenic
1039107625 8:34006251-34006273 TAACAATGACCTTAGGAAGAAGG + Intergenic
1039933202 8:42013814-42013836 GAACAATGACTTAGTCAAGAGGG + Intronic
1042430695 8:68703084-68703106 CAAAATAGACTTAAGGAAGATGG - Intronic
1043864514 8:85360117-85360139 CTAGAAGGATTTATGGAAGAAGG - Intronic
1044648340 8:94468398-94468420 CAACCATGACATATGTAAAAAGG + Intronic
1050383684 9:5060742-5060764 CATCAGTGATTCATGGAAGAAGG - Intronic
1050384942 9:5079467-5079489 CAACAAGCATTTATGGCAGATGG - Intronic
1051512660 9:17896352-17896374 CATCAATGACTTAAGTAATATGG + Intergenic
1051758037 9:20426861-20426883 CTACAATCACTCATGAAAGATGG + Intronic
1052064400 9:23999052-23999074 CAACAATGAGTTGTGGAAAAAGG - Intergenic
1052461122 9:28764852-28764874 CAATAATGACCTATGCAAAAAGG + Intergenic
1056237507 9:84609829-84609851 CAACAACTATTTATGGAAAAGGG + Intergenic
1056838800 9:89981032-89981054 CTTCAATGACTTAGGGAGGATGG + Intergenic
1058340001 9:103883448-103883470 CAAAAATGACTTGTACAAGAAGG + Intergenic
1058500351 9:105608784-105608806 CCACAATGACTTAAGGAAATAGG - Intronic
1185534809 X:852570-852592 CTCCAATAACTTATGGAAAAGGG - Intergenic
1185749151 X:2596771-2596793 CATCCATAAATTATGGAAGAGGG - Intergenic
1187348845 X:18493101-18493123 CAACATAAACTCATGGAAGAAGG - Intronic
1188121139 X:26309603-26309625 ATATAATGACTTATGAAAGATGG - Intergenic
1189263418 X:39694455-39694477 CAACAATGTCTGAAGGAAGTGGG + Intergenic
1190148073 X:47916331-47916353 CAACTCTGACTTCTGGATGAAGG - Exonic
1194324526 X:92496608-92496630 CGACAATGGATTATGGAATATGG + Intronic
1196323021 X:114366098-114366120 AAACAATAACTTATATAAGAAGG + Intergenic
1196614535 X:117752849-117752871 CAAGAATGACTGAAGGAAGAAGG + Intergenic
1196744193 X:119054760-119054782 CAACAACAACTTCTGGATGATGG + Intergenic
1196979289 X:121193891-121193913 CAAAAATGACATATGTAAGAAGG - Intergenic
1199338765 X:146650940-146650962 CAAAAATGATTTATGGTAAATGG - Intergenic
1200633269 Y:5615817-5615839 CGACAATGGATTATGGAATATGG + Intronic