ID: 955086999

View in Genome Browser
Species Human (GRCh38)
Location 3:55712484-55712506
Sequence ACTTCTCTGCAGAAGATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 443}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955086994_955086999 29 Left 955086994 3:55712432-55712454 CCTCTGTTGAACCATTAGCAGGA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG 0: 1
1: 0
2: 0
3: 31
4: 443
955086995_955086999 18 Left 955086995 3:55712443-55712465 CCATTAGCAGGAATAAATGTTAG 0: 1
1: 0
2: 1
3: 19
4: 182
Right 955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG 0: 1
1: 0
2: 0
3: 31
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955086999 Original CRISPR ACTTCTCTGCAGAAGATTGT TGG Intronic
901350748 1:8593671-8593693 ACTGCTCTGCAGTGGATTGGGGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904486419 1:30827501-30827523 ACTGATGTGCAGAAGATTCTAGG - Intergenic
904551056 1:31318468-31318490 ACAACTCTGCAGAAGACTGAGGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906877421 1:49554242-49554264 ACTTCTCTGCATAGCACTGTTGG - Intronic
908537818 1:65094578-65094600 ACTTCTGTGAAGAATAATGTTGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
916002243 1:160628238-160628260 AGTTCTCTGCTGAAGATTGAAGG + Intronic
916981993 1:170148063-170148085 ACTTTTCTGCATAGGATTGGGGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917323628 1:173809694-173809716 ACTTTTCTTCATATGATTGTTGG - Intronic
917573035 1:176289664-176289686 ACTTCTGTGCAGAATATCATTGG + Intergenic
918412342 1:184272864-184272886 TCTTCTCTTCAGAAGATACTGGG + Intergenic
918716082 1:187788774-187788796 AGTTCTCAGCAGAAGATTTGAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920727874 1:208453881-208453903 GCTTCTTTGCAGAAGATATTGGG - Intergenic
921095368 1:211882829-211882851 AGTTCCCTGAAGAATATTGTGGG - Intergenic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923660942 1:235956786-235956808 ACTTCTGTGAAGAACATTATGGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063083518 10:2791265-2791287 TCTACTCTGCAGAAGTTTGTAGG - Intergenic
1064023403 10:11827287-11827309 ACATCTCTTCAGATGCTTGTTGG + Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065973259 10:30821918-30821940 AATTCTCTAAAGAAGATTGAGGG + Intronic
1066335049 10:34467885-34467907 CCTTCTCTGCAGAAGAGCCTGGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067665871 10:48278508-48278530 AGTTCTGTGAAGAATATTGTTGG + Intergenic
1067844457 10:49708884-49708906 AGTTCACTTCAGAAGATGGTGGG - Exonic
1068576899 10:58694348-58694370 ATTTCTCTTCTGAAGTTTGTTGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072434510 10:95403075-95403097 ACTTCTCTGCAGAAGAACGATGG + Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075596587 10:123735108-123735130 ACTTCTCTGCTAGAGCTTGTAGG - Intronic
1076273285 10:129174996-129175018 ATTTCTCTGGAGAGAATTGTTGG - Intergenic
1076513416 10:131028322-131028344 ATTTCTCTGGATAACATTGTAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1079976207 11:27094548-27094570 ACTTGTATCCAGTAGATTGTTGG - Intronic
1080427235 11:32167317-32167339 TTTTCTCTCCAGAAAATTGTGGG + Intergenic
1080480825 11:32648046-32648068 CCTACTTTGCAGAAGATTGGAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081062792 11:38501931-38501953 AATTCTGTGAAGAAGAATGTTGG + Intergenic
1081103678 11:39037078-39037100 ATTTCTCTGAGAAAGATTGTTGG + Intergenic
1081878359 11:46426676-46426698 TCTTTTCTTCAGAACATTGTAGG - Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082764203 11:57154073-57154095 ACTTCTGTGCATAGCATTGTGGG + Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085161008 11:74345132-74345154 ACTTCTCTCCAAAAAGTTGTAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1088071979 11:105798326-105798348 ACTTCTGTGGAAGAGATTGTTGG + Intronic
1088120376 11:106362065-106362087 ACTTGTATGCAGAACATTCTTGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089361192 11:117887768-117887790 ACTTCTCTTAAGCAGATTGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090259568 11:125308876-125308898 ACTACCATGCAGAAGATGGTTGG - Intronic
1090866318 11:130703935-130703957 ACTTCTGGGCAGAAGAGTCTTGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097930115 12:65174064-65174086 AGTTTTCACCAGAAGATTGTAGG + Intronic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099344363 12:81479750-81479772 ATCTCTCTGCAGAAGAGTGGAGG - Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101296611 12:103430343-103430365 GCTTTTCTTCATAAGATTGTTGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103888423 12:124220546-124220568 TTTTCTCTGAAGAAGATTTTGGG + Intronic
1105360400 13:19708692-19708714 ACTTCTGTGCACAACACTGTAGG + Intronic
1105877198 13:24567725-24567747 ACTTCTGTGCACAATACTGTAGG - Intergenic
1107117962 13:36767315-36767337 ACTCCTCAGGAGATGATTGTGGG - Intergenic
1107266479 13:38561727-38561749 ACATCTCTACAGAAGATCCTGGG - Intergenic
1108888922 13:55228579-55228601 ACTTCTCTGAAGAAGTTTCCTGG + Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110046944 13:70842837-70842859 AGGTCTCTGCAGAGGATTGAAGG - Intergenic
1110400485 13:75084528-75084550 TTTTCTCTGCAGAATATTCTAGG - Intergenic
1110734213 13:78916187-78916209 GCTACTCTGCTGAATATTGTAGG - Intergenic
1111001131 13:82183967-82183989 TCTTCTGTGCAGAAGCTTTTTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114793668 14:25687342-25687364 TTTTCTCTGCAGTAGATTGAAGG - Intergenic
1115779011 14:36748877-36748899 ACTGATCTGGAGAATATTGTGGG - Intronic
1115902836 14:38173072-38173094 ACTTCTCTCCTGAACATAGTGGG - Intergenic
1116174333 14:41447848-41447870 TCTTCTCTTCTGAAGATCGTGGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116527301 14:45920774-45920796 ATTTCTCTGCATAAGTTTTTTGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116803629 14:49469070-49469092 ATTTCTGTGAAGAATATTGTTGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117436931 14:55724436-55724458 ACTTCTGTGCAGAAGTTTTCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1202830467 14_GL000009v2_random:23325-23347 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1123704227 15:22939608-22939630 ACATTTCTGCAGATGACTGTAGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126660280 15:51026282-51026304 ACTTCTCAGCAGAACCTTATAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127490519 15:59458169-59458191 ACTTCTCTGTAGAATTTTGCAGG - Intronic
1127556438 15:60092092-60092114 AGTTCTTTGCAGAGAATTGTGGG - Intergenic
1127886275 15:63203979-63204001 TCTTCTCTGCAGAGGGTTGTCGG + Intronic
1128172967 15:65529355-65529377 TCTTCTCTGCAGAAGAACTTGGG + Intergenic
1129929468 15:79398433-79398455 ACTTGTAGGCAGCAGATTGTAGG - Intronic
1130429043 15:83828055-83828077 AATTCTGTGAAGAAGATTGGTGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134324803 16:13197558-13197580 CCTTCTTTGAAGACGATTGTTGG + Intronic
1134915413 16:18066143-18066165 ATTTTTCTGAAGAATATTGTTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137502873 16:49024770-49024792 ACCTCTCTCTTGAAGATTGTAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139211476 16:65082127-65082149 ACTTTTCTGGAAAAGAATGTAGG - Intronic
1141322185 16:83021576-83021598 AGGTTTCTGCTGAAGATTGTTGG + Intronic
1141391757 16:83670578-83670600 ACTTCTCTCCTGCAGAATGTGGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1144117526 17:12113245-12113267 ACTTCTGTCCAGAAGAATATTGG - Exonic
1145860669 17:28207320-28207342 ACTTATCTGTAGAAGAATCTGGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149939478 17:60848007-60848029 ATTTCTCTGCAAAAGAATGAAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152181758 17:78826544-78826566 ACTTCTCTAAAGAACATTCTAGG + Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153300876 18:3591060-3591082 ACTAATCTGCAGCAGATTGAGGG + Intronic
1154069589 18:11141372-11141394 GCTTCTCGGAAGAAGATTCTGGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156061931 18:33088683-33088705 ACTACTCTGCAGCAGTGTGTTGG - Intronic
1156272258 18:35546621-35546643 ACTTCTATGAAGAACATTATTGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157356539 18:46940373-46940395 TCCTCTCTGCCAAAGATTGTTGG - Intronic
1157364548 18:47052075-47052097 ACTTTTCAGGAGAAAATTGTTGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159054948 18:63454128-63454150 ATTTCTCTGCAAAATATTGAAGG + Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159667106 18:71174981-71175003 ACTCCTATGCAGAGGATAGTGGG - Intergenic
1159742927 18:72195525-72195547 ACTTCTGGCTAGAAGATTGTCGG + Intergenic
1162276463 19:9659506-9659528 ACTTCTGGGCATAAGAATGTGGG - Intronic
1162648394 19:12066362-12066384 ACTTATCTGCAGAAGTATCTTGG + Intronic
1163782919 19:19259791-19259813 AGTTCTCTTTAGAAGATTCTAGG - Intronic
1164018995 19:21280304-21280326 ACTTCTGTGAAGAACATTGGTGG + Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202642226 1_KI270706v1_random:104454-104476 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927480552 2:23450492-23450514 CCTTCTCTGCAGAACATTAGGGG + Intronic
927800350 2:26093218-26093240 ACCTCTTTGCAGAAGTTTATGGG + Intronic
928551633 2:32377444-32377466 ACTTCTCTAAAGAACATTATTGG - Intronic
935075144 2:99734912-99734934 AATTCTCTGAAGAAGGGTGTAGG + Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939323261 2:140651772-140651794 ACTTCTGAGCTGAAGATTGGAGG + Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940659677 2:156531409-156531431 ACTTCTCTCCAGAAGATGCAAGG + Intronic
940783840 2:157960849-157960871 ACTGCTCAGCAAAAGATTGGTGG - Intronic
940818182 2:158319823-158319845 AATACTCTGCAGCTGATTGTGGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942478367 2:176353777-176353799 ACATCTGTGCAGAAGCTTTTTGG + Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943559417 2:189442751-189442773 ACTCATATGCAGAATATTGTGGG - Intronic
944227043 2:197358280-197358302 AGTTCTCTGAAGAAGGTTATAGG + Intergenic
944469355 2:200036328-200036350 CCTGCTCTGCTGAAGAGTGTGGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948154363 2:235769385-235769407 ACTCTTTTGCAGAAAATTGTTGG + Intronic
1169624263 20:7545848-7545870 ATTTCTGTGAAGAATATTGTTGG - Intergenic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1170511224 20:17078873-17078895 ACTCCTCTGCAGAAGTCTGATGG - Intergenic
1170824619 20:19783267-19783289 ACTTCTCTGCTGATGTTTGTGGG - Intergenic
1171995959 20:31731585-31731607 ACTCCTCTGGAGAAGGTTGCAGG - Intergenic
1172514578 20:35523919-35523941 AATTCTCTTCAGAAGATTCCAGG - Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1176609653 21:8868163-8868185 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179111973 21:38455166-38455188 ACTTTTCTTCAGAAGTTTGAGGG - Intronic
1180359708 22:11877395-11877417 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180733117 22:17996774-17996796 ACTTCAATGCAGTACATTGTGGG - Intronic
1180992578 22:19946012-19946034 ACTTTTGTTCAGAATATTGTTGG - Intronic
1181517809 22:23425765-23425787 ACTTCAATGCAGTACATTGTGGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950096098 3:10331550-10331572 ACTGCTCTGGACAAGACTGTGGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952642981 3:35620357-35620379 ACTTCTTTTCATATGATTGTTGG - Intergenic
954723286 3:52584420-52584442 ACTTTTCTGCAGATAATTGGGGG - Intronic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
955178138 3:56637829-56637851 ACTTCTCTGCAGATGGTCATAGG - Intronic
955414188 3:58677864-58677886 ACATGTCTGCAGAAGTTTGCTGG + Intergenic
955734597 3:62024618-62024640 CCTTCTCTGTAGAATATTTTTGG + Intronic
955915225 3:63900968-63900990 CCTTCTCAGCAGCAGATTGTAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957647084 3:82944601-82944623 ACTCCTCAGGAGAAGATTATAGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
964103909 3:153019340-153019362 ACATTTCTGGAGAAGGTTGTGGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965006796 3:163037427-163037449 ACTTCTGAGCAGAAGATTTAAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965233351 3:166082635-166082657 ACTTGTCTGCATAAGATTATTGG - Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965318160 3:167216588-167216610 AGTTCTGTGAAGAATATTGTTGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967280777 3:187821551-187821573 ACTTGGCTGCAGAAGGTTGGTGG + Intergenic
1202736335 3_GL000221v1_random:2932-2954 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971118062 4:23670707-23670729 ACATATCTTCAGTAGATTGTTGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973151508 4:46894129-46894151 AGTTCTGTGAAGAACATTGTTGG - Intronic
973240323 4:47949469-47949491 GCTTGTATGCAGAAGTTTGTTGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975008824 4:69323312-69323334 TCTTTTCTGCAGAAGATAATCGG - Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976046089 4:80949844-80949866 ATTTCTCTGCACAAGATGCTTGG - Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979596565 4:122541472-122541494 AATTCTGTGCAGAAGAGGGTGGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980845156 4:138315247-138315269 AGTTCTCTGAAGAATGTTGTGGG + Intergenic
982225848 4:153165668-153165690 ATTTCTCTTCAGAATTTTGTAGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983699101 4:170569368-170569390 ACTACTCTGCAGAAGTTAGAAGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1202769598 4_GL000008v2_random:190334-190356 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
985846371 5:2352530-2352552 ACATCTGTGCAGAAGAGTGTGGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986468321 5:8049479-8049501 TCATTTCTGCAGAAGAGTGTTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988095106 5:26596956-26596978 ACTTTTCTGAAAAAAATTGTGGG - Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989100787 5:37821125-37821147 ACTCCTCTGCAGAGGATGCTGGG + Intronic
989258021 5:39387180-39387202 AATTCTCTGCAGAAGTCTGAAGG + Intronic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993526162 5:88968285-88968307 ATTTCTCTGTAGAATGTTGTTGG - Intergenic
993629571 5:90269331-90269353 ACTTCTCTGTAGAATTTTGTGGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995385670 5:111586199-111586221 GGTTCTCTGCAGCAGATTATGGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998602101 5:143595118-143595140 AGTTCTCAGCATGAGATTGTTGG - Intergenic
999381661 5:151125721-151125743 AGATCTTTGCAGATGATTGTAGG - Intronic
999419572 5:151429047-151429069 ACTGCTCTGCACAGGATTGTAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001379575 5:171295241-171295263 TCTTCTCTGCTGAGGACTGTGGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003044171 6:2717643-2717665 AATCCTCAGCAGAAGCTTGTGGG + Intronic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005634812 6:27743424-27743446 ATTTCTCTGCAGAAAAGTGCTGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008077440 6:47159825-47159847 AAGTCTTTGCAGAAGTTTGTGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010800793 6:80173387-80173409 GCTTCTCTGCAGAAGAAATTAGG + Intronic
1010898731 6:81399748-81399770 AATTCTGTGAAGAAAATTGTTGG - Intergenic
1010987527 6:82442000-82442022 ACTTCTCTGGAGAAGATGGGGGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011115070 6:83880885-83880907 ACTTATTTGCAGATGACTGTAGG - Intronic
1011290843 6:85775591-85775613 TCTTTTCAGCAGCAGATTGTTGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012420573 6:99060258-99060280 ACTTATCTGCAGAAGTTAGGAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014343083 6:120232902-120232924 ATTTCTCTGTAGAGGATTGCTGG - Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015417065 6:132961520-132961542 ACTTCTCTGCAGTAGATATCAGG - Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015834696 6:137407681-137407703 AGTTCTGTGAAGAATATTGTTGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016468568 6:144350634-144350656 ACTTCTCTGCATATGTTTATTGG + Intronic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017235505 6:152113501-152113523 ACTTCTCAGCACAATGTTGTAGG - Intronic
1017343015 6:153348098-153348120 ACTTTTTGGCAGAAGATTATGGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020523590 7:9227806-9227828 ACTACTCTGCAGAATATTCATGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021385231 7:20021291-20021313 ACTTCTCTTCAGAAGCTTCTAGG - Intergenic
1022112012 7:27237615-27237637 ACTGCTCTGCCGAAGCATGTGGG - Intergenic
1023646400 7:42320868-42320890 ACTTCTCTTCTGAAGATTTAAGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024663477 7:51521636-51521658 ACTTGTCTTGAGAAGACTGTAGG + Intergenic
1024856049 7:53780493-53780515 ACTACTCTTAAGCAGATTGTAGG + Intergenic
1026153742 7:67809872-67809894 ACTTCTCTGCTTAATACTGTTGG + Intergenic
1026402486 7:70028876-70028898 ACTCCTCTGCTGAAGATTCACGG + Intronic
1028504966 7:91560676-91560698 ACCTCACTGCAGAAGCTTGCTGG - Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1028608757 7:92684496-92684518 GCTCCTGTGCAGAACATTGTGGG - Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1031825986 7:126566197-126566219 TTTGCTCTGCAGAAGATTTTTGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033506686 7:142010053-142010075 CTTTCTCTGCAGATGATTCTTGG + Intronic
1034653360 7:152709922-152709944 TCTTCTCTGCTGAAGCTTTTGGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038147046 8:24906915-24906937 CCTTCGCTGCTGAAGATTGTGGG + Intergenic
1039152088 8:34517612-34517634 ACTTTTCTGCAGAATAGTCTGGG - Intergenic
1039536436 8:38318623-38318645 ACTTTTCTCCATAAGATTCTGGG - Intronic
1041576102 8:59397327-59397349 ACTCCTCTGCAGAAAAATATTGG + Intergenic
1041988887 8:63960682-63960704 ACTTCTCTGAAGAAAATCTTAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042401130 8:68348488-68348510 ATTTCTATGAAGAACATTGTTGG + Intronic
1043157501 8:76802469-76802491 ACTTGCTTGCAGAAGCTTGTAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044214129 8:89587384-89587406 AGTTCTTTGAAGAATATTGTTGG + Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044286876 8:90420098-90420120 AATTCTGGGCAGAAGAGTGTGGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045675335 8:104601162-104601184 CCTTCTCTTAAGAAGAATGTAGG - Intronic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1048685229 8:136897487-136897509 ACTTCTATGGAGCAGAATGTGGG + Intergenic
1048752945 8:137700168-137700190 AGTTCCCTGCAGAAGCTTCTTGG + Intergenic
1049051073 8:140197086-140197108 ACTTCTCCACAGAAAACTGTGGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050720948 9:8588810-8588832 ATTTCTCTGAAGAAGAATGAGGG - Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051023296 9:12572013-12572035 ACTTTTCTGCAGGAAATTTTTGG + Intergenic
1051137654 9:13940817-13940839 ACTTCTGAGCACAACATTGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052635055 9:31092553-31092575 ACTTCTTTTCATATGATTGTTGG - Intergenic
1055802096 9:80049442-80049464 ACTGCTATTCAGAAGAGTGTGGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056157876 9:83857104-83857126 ACTTGTCTGTAGTAAATTGTTGG + Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203694491 Un_GL000214v1:84061-84083 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203705064 Un_KI270742v1:33371-33393 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1203558945 Un_KI270744v1:32440-32462 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203641782 Un_KI270751v1:20002-20024 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186985185 X:15005177-15005199 CCTTCTCAGCAGAAGCTTATAGG + Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187711678 X:22060701-22060723 ATTTCACTTTAGAAGATTGTGGG + Intronic
1188116743 X:26254124-26254146 AATTCTGGGCAGAAGAGTGTAGG + Intergenic
1189730364 X:44014026-44014048 ATTTCTCTGAAGATGGTTGTAGG - Intergenic
1191192947 X:57686049-57686071 ATCTCTCTGCAGAAGAGAGTGGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191781513 X:64872905-64872927 ACTTCCCTCCAAAAGATTCTAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192705485 X:73525436-73525458 ACTTCTGTCCAGAAGAATATTGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192984449 X:76381514-76381536 ATTTCTCTGCAGAAGAGCATGGG + Intergenic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196598888 X:117578205-117578227 ATTTCTGTGAAGAATATTGTTGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197109973 X:122761190-122761212 TTTGCTCTGCAGAAGATTTTTGG - Intergenic
1197242867 X:124138287-124138309 AGTTCTGTGAAGAATATTGTTGG + Intronic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1202023785 Y:20497143-20497165 ACTTCTGTGAAGAATGTTGTTGG + Intergenic