ID: 955087273

View in Genome Browser
Species Human (GRCh38)
Location 3:55715463-55715485
Sequence TCATTCCCACACACTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955087273 Original CRISPR TCATTCCCACACACTGAACT TGG Intronic
903305928 1:22413275-22413297 ACTTTCCAGCACACTGAACTGGG + Intergenic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
903783626 1:25840594-25840616 TTATTCCCTCACCTTGAACTTGG + Intronic
904962914 1:34349004-34349026 TCAATCCCACACATTTACCTCGG + Intergenic
907174557 1:52506379-52506401 TCATATTCACAGACTGAACTGGG + Intronic
908068866 1:60436531-60436553 TCAGTCAGACCCACTGAACTAGG - Intergenic
908469084 1:64424363-64424385 TCTTCCCTACACACAGAACTTGG - Intergenic
909901812 1:81147095-81147117 TGGTTTCCCCACACTGAACTGGG - Intergenic
913800944 1:122704875-122704897 TCATTCCCACAAACTGCGTTGGG + Intergenic
913809237 1:122854475-122854497 TCATTCCCACAAACTGCGTTGGG + Intergenic
913819109 1:123030542-123030564 TCATTCCCACAAACTGCGTTGGG + Intergenic
913858889 1:123745130-123745152 TCATTCCCACAAACTGCGTTGGG + Intergenic
914265061 1:146031497-146031519 TCATTACCACTCACTGAGTTTGG + Intergenic
914323931 1:146592545-146592567 TCATTCTCACAGGCTGATCTGGG + Intergenic
915804504 1:158830157-158830179 TGGTTCCCAAACACTGAAGTGGG + Intergenic
919940786 1:202284636-202284658 ACATTTCCAAACACTGACCTAGG - Intronic
921563744 1:216690752-216690774 TCATTTACACACAATGGACTAGG + Intronic
922469673 1:225868305-225868327 CCTTTCCCACACACGTAACTTGG - Intronic
922481656 1:225943510-225943532 TCATTTCCAGACACAGAACAAGG - Intergenic
923145150 1:231192603-231192625 TCATTCACACACAAAGGACTGGG + Intronic
1063923020 10:10950262-10950284 TCAGACACACACACTGCACTGGG - Intergenic
1068639577 10:59388191-59388213 CCCTCCCCAGACACTGAACTGGG - Intergenic
1069273080 10:66555077-66555099 AAATTTCCACACCCTGAACTTGG - Intronic
1070421250 10:76239276-76239298 TCATTTCTACACACTGCATTAGG + Intronic
1072298938 10:94040397-94040419 TCATTCCCAGCCACTGCTCTGGG - Intronic
1073038283 10:100579627-100579649 TCCTTCCCACACACTCACCCTGG - Intergenic
1074031789 10:109696539-109696561 TTATTGCCACAATCTGAACTGGG - Intergenic
1076141467 10:128081934-128081956 TCTTTCCAACACATTGCACTTGG - Intronic
1076562229 10:131374709-131374731 TCATTCATACACAGTGATCTTGG - Intergenic
1080348007 11:31347257-31347279 TAATTCCTTCACAGTGAACTAGG + Intronic
1080785580 11:35472385-35472407 TCTGTCCCAGACACTGTACTAGG + Intronic
1081423030 11:42894683-42894705 TCATTTCTAAACACTGAATTGGG - Intergenic
1083145239 11:60753140-60753162 GCATTCCCAGTCCCTGAACTTGG + Intergenic
1083250043 11:61460514-61460536 TCCTTCAGGCACACTGAACTTGG - Intronic
1087027924 11:93670190-93670212 GCTTTCCCACACTCTGAATTTGG + Intronic
1088135662 11:106552703-106552725 CCAGTCCCACAGACTGAAGTGGG + Intergenic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1091622764 12:2101693-2101715 TCACTGTCACCCACTGAACTGGG - Intronic
1092468586 12:8757613-8757635 TCTTCCCCACATCCTGAACTTGG + Intronic
1093758560 12:22880164-22880186 ACATTCACTCACACTGCACTCGG + Intergenic
1095321644 12:40835635-40835657 TCAATCCCACACACAGAATCAGG + Intronic
1096427396 12:51515815-51515837 TCATTCACACGCTCTGAAATTGG - Intergenic
1097373577 12:58814251-58814273 TCATTCTCACCCACTAAATTAGG + Intergenic
1103150375 12:118633118-118633140 TCAGTCCCCCATACTGAACCCGG - Intergenic
1104002815 12:124871121-124871143 TCATCCACACACACTGACCAAGG + Intronic
1104510301 12:129371781-129371803 ATATCACCACACACTGAACTAGG - Intronic
1106973732 13:35179475-35179497 TCATTTCCAAAGACAGAACTGGG + Intronic
1108091611 13:46855476-46855498 CCATCCACCCACACTGAACTGGG - Intronic
1109462557 13:62680579-62680601 TAATTCCCACCCACTGATCTTGG - Intergenic
1111296248 13:86281967-86281989 TAACTCTCACACACAGAACTTGG - Intergenic
1111842944 13:93473118-93473140 CCAGTCCCACTCACTGAAGTGGG - Intronic
1111923566 13:94438898-94438920 TTATTCCCACATAATGCACTGGG - Intronic
1112609777 13:100945136-100945158 TCTTTCACACAAACTGAACAAGG + Intergenic
1113859776 13:113473747-113473769 TCATCCCAACACTCTGAAGTGGG + Intronic
1114797630 14:25734741-25734763 ATATTCCCACACACTGATTTGGG - Intergenic
1116611865 14:47084827-47084849 CCATGCCAACACACTGATCTTGG + Intronic
1117383032 14:55184527-55184549 TCATCCCCTCACACTGAATAGGG + Intronic
1117427579 14:55616744-55616766 TCATTAGCACACATTAAACTGGG - Intronic
1117532645 14:56674471-56674493 TCATTCCTCCAGACTGAAATCGG - Intronic
1119007934 14:70950285-70950307 TCATTGCCAGACACTGATTTTGG - Intronic
1120285614 14:82496797-82496819 ACCTTCCCACACACTGAAGTAGG - Intergenic
1120711813 14:87800283-87800305 TCATTCTCTCACAGTGAGCTGGG - Intergenic
1121331550 14:93052779-93052801 TCAGTCCCTCACTCAGAACTGGG + Intronic
1122566363 14:102659839-102659861 ACATTCCCAAACACTGATCTAGG - Intronic
1123501191 15:20882609-20882631 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123558443 15:21456314-21456336 TCCTTCCCATACAGAGAACTGGG - Intergenic
1123594674 15:21893589-21893611 TCCTTCCCATACAGAGAACTGGG - Intergenic
1124626431 15:31310092-31310114 TCATCCCCACAGATTGAATTTGG - Intergenic
1127621704 15:60740392-60740414 TCATTCGCAGACACAGAATTCGG + Intronic
1128059736 15:64727745-64727767 TCACTCCCACTCACCTAACTGGG + Intergenic
1130958834 15:88646421-88646443 GCATTCACACACACTGAGCATGG - Intronic
1131217749 15:90553596-90553618 TTGGTCCCACACACTGAATTAGG + Intronic
1131445514 15:92495417-92495439 TATTACCCACACACAGAACTGGG - Intronic
1202966793 15_KI270727v1_random:183464-183486 TCCTTCCCATACAGAGAACTGGG - Intergenic
1133026334 16:2990445-2990467 TCTTTCCCAGACACTGAAGGGGG + Intergenic
1133490667 16:6264936-6264958 CGGTTCCCACACACAGAACTCGG - Intronic
1133842127 16:9419540-9419562 ACATTCACACACACAGAACCTGG + Intergenic
1134045605 16:11098764-11098786 TTACTCCCACACACAGCACTTGG - Intronic
1134204884 16:12229026-12229048 TCATTCCTTCACACAGACCTTGG + Intronic
1135604527 16:23811863-23811885 TCATGGCCACACCCTGGACTTGG + Intergenic
1136672981 16:31874293-31874315 TTCTTCCCACACACCGAACCTGG - Intronic
1138923670 16:61564935-61564957 TCACTTCCACAAACTGAACTGGG - Intergenic
1138923787 16:61566090-61566112 TCACCTCCACAAACTGAACTGGG - Intergenic
1139008784 16:62607088-62607110 TCAGCCCTACACACTGAGCTTGG - Intergenic
1139030111 16:62869647-62869669 TTTTTCCCAAACACTGATCTGGG - Intergenic
1140009631 16:71118299-71118321 TCATTCTCACAGGCTGATCTGGG - Intronic
1147389059 17:40098356-40098378 CCACTGACACACACTGAACTGGG + Intronic
1150715480 17:67569341-67569363 TCATTTCCCGACACTGAACCTGG + Intronic
1153927852 18:9850164-9850186 TCATTCCGGCAAACAGAACTTGG - Intronic
1155746748 18:29363616-29363638 TCATTCCCACTTGCTGCACTGGG + Intergenic
1157067925 18:44373810-44373832 TCAGGCACACACACAGAACTGGG - Intergenic
1157474298 18:48011540-48011562 TCATTCCCAAACATTCACCTTGG - Intergenic
1158653900 18:59311285-59311307 TCATTCACAACCAATGAACTTGG - Intronic
1159022932 18:63157748-63157770 TCCTTCCCAAACACTGAAATAGG + Intronic
1159288528 18:66386380-66386402 TTATTCCCACTCACTCACCTAGG + Intergenic
1160691815 19:463813-463835 TGTTTCCCACACAGTGAACGGGG - Exonic
1160996473 19:1884450-1884472 CCGTTCCCACGCACTTAACTGGG + Intronic
1161066524 19:2241205-2241227 GCACTCCCACACACAGATCTCGG - Intronic
1161999502 19:7734375-7734397 TCATTTCCACTCCCTGAACCAGG - Intergenic
927170287 2:20363645-20363667 TCATTCTCACACACTGCACACGG - Intergenic
930048181 2:47192403-47192425 TCAGTGCCAGACCCTGAACTAGG - Intergenic
930600437 2:53436593-53436615 CCATTACCACAGACTGGACTTGG + Intergenic
931594133 2:63922543-63922565 TCATTCTCACACTCTGAGGTAGG + Intronic
931729071 2:65137149-65137171 TCCTTCTAAAACACTGAACTGGG - Intergenic
935795996 2:106642132-106642154 TCATTCTCACACACTGTGTTGGG - Intergenic
936051000 2:109223492-109223514 TCATTTCCAGCCACTGACCTAGG - Intronic
937460049 2:122077780-122077802 TCATTCCCAAACACTTATGTAGG - Intergenic
937462672 2:122102922-122102944 TGATTCCCAAATACTGAACATGG - Intergenic
938404020 2:131017409-131017431 TCAATCCCACACCCTGTGCTGGG + Intronic
939605082 2:144244570-144244592 TCAGTCACACACATTAAACTAGG + Intronic
939650638 2:144757883-144757905 TCTTCCCCACACCCTGAAGTCGG + Intergenic
941000546 2:160198301-160198323 TCATGGATACACACTGAACTCGG + Intronic
941506201 2:166348707-166348729 TCATTCCCACCCACCTATCTAGG + Intronic
942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG + Intronic
945416285 2:209576918-209576940 TCATTCTCATGTACTGAACTAGG + Intronic
945421265 2:209639822-209639844 TCTGTGCCACACACTGTACTTGG + Intronic
945546195 2:211155201-211155223 CCCTTGCCACACACTGACCTGGG + Intergenic
946815162 2:223569598-223569620 TCATTGCCTCACACTGATCTAGG - Intergenic
946885078 2:224215142-224215164 TCCTTCCCACACCTTGATCTTGG - Intergenic
947906778 2:233770236-233770258 TGATTCCAACACTCTGAGCTGGG + Intronic
1168754740 20:308596-308618 TCATTGACACATACTGAACAAGG + Intergenic
1169406453 20:5325145-5325167 TCATTCCCACAGAATGCTCTTGG + Intergenic
1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG + Intronic
1172391524 20:34568457-34568479 GCCTTCCCACACACAGACCTGGG + Intronic
1172628505 20:36362651-36362673 TCATTGCCACACGCTGTACCTGG - Intronic
1174147945 20:48465253-48465275 TTAATCCCAGACACTGAGCTGGG - Intergenic
1174590367 20:51640236-51640258 TCAGCCTCACACACTGCACTGGG + Intronic
1175644651 20:60660521-60660543 TCAGTCCCACCCACTGTACAGGG - Intergenic
1176227574 20:64010372-64010394 TCACTTCCAGACACTGAACCTGG - Intronic
1176936190 21:14869944-14869966 TCCTTCCAACTAACTGAACTAGG + Intergenic
1176972806 21:15286605-15286627 TGATTCACACACACTGAGGTGGG - Intergenic
1177363724 21:20105657-20105679 TCATTCCCAGACTCAGAAATTGG - Intergenic
1177713113 21:24805608-24805630 TTATTCTCACAAATTGAACTGGG + Intergenic
1178245451 21:30946897-30946919 TCATTTCCACCCAATAAACTTGG + Intergenic
1178537417 21:33421811-33421833 TCAAACCCACACTCTGACCTTGG + Intronic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1182070291 22:27458694-27458716 TCCTTCCCACAGCCTGACCTTGG - Intergenic
1184542535 22:45137405-45137427 ACATTCACAGACACTGTACTGGG + Intergenic
1185131215 22:49040069-49040091 CAATTCCCATACACAGAACTTGG + Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949331024 3:2922337-2922359 TCATCCTCAAACACTGACCTAGG - Intronic
949533063 3:4976518-4976540 TCAATGCCAGACACTGAAATAGG - Intergenic
950021660 3:9792261-9792283 TCTGTGCCAGACACTGAACTGGG - Exonic
951274323 3:20666723-20666745 TCATTTCCACTTACTGCACTAGG - Intergenic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
953576446 3:44116537-44116559 TCAGTGCCAGACACTGAACTAGG - Intergenic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
957659145 3:83124033-83124055 TCATTCCCAAACACTAAAATTGG - Intergenic
958510947 3:95048232-95048254 GCATTCCCACATACTGGACCAGG + Intergenic
960408264 3:117288669-117288691 TCATCCCCACATACTCAAGTTGG + Intergenic
961212881 3:125139582-125139604 TCTTTCCCACACCCTGAACCTGG + Intronic
965005632 3:163019144-163019166 TCAGTCCCACAGACTGAAGTGGG + Intergenic
967906899 3:194509006-194509028 TCACTCCCACACTCAGAACAAGG - Intergenic
971352819 4:25868112-25868134 TCTTTCCCCCACCCTGAGCTGGG + Intronic
971650216 4:29262153-29262175 TCTTTCACACACAATGAAATGGG + Intergenic
972412926 4:38811030-38811052 ACATACCCATACACTGAACATGG - Intronic
972739971 4:41879755-41879777 TCCTCCCCACCCACTGACCTGGG + Intergenic
973793411 4:54399102-54399124 TTTTTCCCACATACAGAACTGGG - Intergenic
974535908 4:63174728-63174750 TCCTTCTCACACACCGAACAGGG - Intergenic
975499598 4:75070071-75070093 TCCTTCCCACATACTTAACAAGG + Intergenic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
978765304 4:112399209-112399231 TCTTTCCCAAACTCTGAACAAGG - Intronic
978884664 4:113752899-113752921 TCAATCCCCCACACTGCAATGGG + Intronic
981777155 4:148382297-148382319 TCAGTGCCAAACCCTGAACTAGG + Intronic
984603279 4:181753832-181753854 TCATACCCACACATTGTACTAGG + Intergenic
985341122 4:188955707-188955729 TCGTTATCACACACAGAACTTGG - Intergenic
985414903 4:189726180-189726202 TAATTGCCAGACACTGTACTGGG - Intergenic
987386015 5:17330431-17330453 TCTTTACCACACACTTAAATGGG + Intergenic
998993482 5:147845008-147845030 GCATGCACACACACTGAACTAGG - Intergenic
1000153127 5:158522973-158522995 ACTTTCCCACACACAGGACTTGG + Intergenic
1000964803 5:167643263-167643285 TCATTCCCACACCCCGCCCTAGG + Intronic
1001399481 5:171437961-171437983 TCATTCCCTCTGCCTGAACTGGG + Intronic
1004602198 6:17161120-17161142 TAATTCCCACTCACTGAGCCAGG - Intergenic
1005520914 6:26599554-26599576 TCATTCCTACAAAGTAAACTGGG + Exonic
1005790236 6:29292527-29292549 TCAAACCCCCACACTGAAATAGG - Intergenic
1007646907 6:43389972-43389994 TCAGCCCCACACACTGACATGGG + Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1015886823 6:137926238-137926260 TCCACCCCACACACTGTACTTGG - Intergenic
1017474258 6:154772334-154772356 TGATTCCCTCACACTAAAGTAGG + Intronic
1018100934 6:160439131-160439153 TAATTGCCAGCCACTGAACTAGG + Intronic
1018670342 6:166171758-166171780 ACATTCCCAAACATTCAACTGGG - Intergenic
1027123402 7:75538354-75538376 TCATTCCTAGACACGAAACTTGG - Intronic
1028827550 7:95290779-95290801 TCTTTCCCACACATTGGAGTAGG - Exonic
1030735481 7:113043058-113043080 TTATTCCCACACACTTTCCTGGG - Intergenic
1034077938 7:148250516-148250538 TCCTTCCCACACGATGCACTCGG + Intronic
1039056374 8:33540375-33540397 TCATTCATCCACATTGAACTTGG - Intergenic
1039260509 8:35766194-35766216 TAATTACCACACACTGTACTAGG - Intronic
1039607513 8:38894263-38894285 TCATTCTCTCACTCTGAACTGGG + Intergenic
1041024644 8:53671586-53671608 TCATTCCAACACACGGTAGTTGG + Intergenic
1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG + Intronic
1047612005 8:126530194-126530216 TCATTCTGACACACTGAACTTGG - Intergenic
1048361991 8:133705329-133705351 TAAGTCCCAGACACTGAAATGGG + Intergenic
1049404501 8:142445887-142445909 TCCTGCTCACACACTGAGCTTGG - Intergenic
1049923417 9:386481-386503 TCATGCCCTCACACTGTGCTTGG + Intronic
1050893463 9:10854940-10854962 TCAATCCGACACAATTAACTAGG - Intergenic
1050962487 9:11752804-11752826 TCATTCCCACTCACAGGATTTGG + Intergenic
1051349624 9:16186703-16186725 TCATACCCACAGTCTGATCTTGG + Intergenic
1051542608 9:18236448-18236470 TCATTCAGACATACTCAACTGGG - Intergenic
1054809706 9:69425246-69425268 GCCTCCCCACACACTGAACTGGG + Intergenic
1056002785 9:82234638-82234660 TCATACCAACACTCTGAAGTAGG - Intergenic
1057510822 9:95678424-95678446 CCAGTCCCACAGACTGAAGTGGG - Intergenic
1059736276 9:117103036-117103058 GCATCCCCACACACTGGGCTAGG - Intronic
1187028933 X:15465893-15465915 TTATTCCCAAACACTGAATGAGG - Intronic
1189972676 X:46434152-46434174 TCATGTGCACACACTGAACTTGG - Intergenic
1190058791 X:47197794-47197816 AGGTTCCCACACACTGAGCTGGG - Intronic
1190573239 X:51806280-51806302 GCATTCTCACAAAGTGAACTCGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1201641670 Y:16185086-16185108 TCATTTCCACCCTATGAACTAGG + Intergenic
1201661145 Y:16400238-16400260 TCATTTCCACCCTATGAACTAGG - Intergenic