ID: 955089696

View in Genome Browser
Species Human (GRCh38)
Location 3:55737322-55737344
Sequence CTGGATATTAATGCTGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955089696_955089698 2 Left 955089696 3:55737322-55737344 CCGGCAGCAGCATTAATATCCAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 955089698 3:55737347-55737369 TCACAGAGCCTGTCTGCCTTTGG 0: 1
1: 0
2: 3
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955089696 Original CRISPR CTGGATATTAATGCTGCTGC CGG (reversed) Intronic
901048358 1:6412768-6412790 CTGGAGATGGATGCTGCTGATGG - Intronic
901071774 1:6523648-6523670 CTGGAGAATGGTGCTGCTGCAGG + Exonic
902412215 1:16218096-16218118 CTGGATCTGACTGCTCCTGCTGG - Intergenic
905385412 1:37600095-37600117 CTTGATATTTATGCTGCAGCCGG + Intergenic
908327350 1:63036234-63036256 GTCCATATTAATGCTGCGGCAGG - Intergenic
913481616 1:119294392-119294414 CTGGAGATTAATGTTCATGCAGG + Intergenic
915159478 1:153907560-153907582 CTGGAGATTAATGCTGGTGTTGG + Intronic
915933262 1:160073695-160073717 CTGGATTTTAATGCCAATGCTGG + Intergenic
917974389 1:180229895-180229917 CTGGGTATAAATTCTGCTGATGG - Intergenic
918707982 1:187692199-187692221 GTGGATATTTATGATGCTCCAGG - Intergenic
921574086 1:216814008-216814030 TGGGATATTAGTGGTGCTGCAGG - Intronic
922634935 1:227158888-227158910 CTGCATATTCCAGCTGCTGCAGG + Intronic
1063169346 10:3493183-3493205 CTGGAAATTGATGATGCTGGTGG + Intergenic
1067697150 10:48543588-48543610 CTGGACAATACTGGTGCTGCTGG - Intronic
1067725994 10:48771515-48771537 CTGGGTATTTAGGCTGCAGCAGG - Intronic
1069978678 10:72236897-72236919 CTGGACTTTAAAGCTGATGCTGG - Intergenic
1072547480 10:96450709-96450731 CTGGCTATAACTGCAGCTGCAGG + Intronic
1072755993 10:98021334-98021356 CTGTCTATGAGTGCTGCTGCAGG - Intronic
1073689206 10:105788696-105788718 CTGGATATTAGTTCTCCTGTTGG - Intergenic
1074149367 10:110744501-110744523 GTGGATATTGCTGCTGGTGCAGG - Intronic
1076190104 10:128476960-128476982 CTGGCTATTACTGCAGTTGCAGG - Intergenic
1079730935 11:23937333-23937355 CTGGATATTTAACCTGCTGTAGG + Intergenic
1088327244 11:108613556-108613578 GTGGATATTAATGCTGCATTAGG + Intergenic
1088877715 11:113949654-113949676 ATTGATGTTAATGCTGGTGCTGG - Intergenic
1090705498 11:129332750-129332772 ATGCATATAAAAGCTGCTGCTGG + Intergenic
1092890890 12:12968344-12968366 CTGGGTATCTATGCTGCTTCTGG + Intergenic
1094430535 12:30364651-30364673 TAAGATATTAATGCTGCTTCTGG - Intergenic
1096682179 12:53263415-53263437 TTTGATATTAAATCTGCTGCTGG - Intergenic
1097958172 12:65507341-65507363 ATGGACATTCATGCTTCTGCGGG + Intergenic
1098946701 12:76597912-76597934 CTGGAGATTAATGTTGCAGTTGG + Intergenic
1104183108 12:126401372-126401394 ATGGACATTTCTGCTGCTGCGGG + Intergenic
1105299357 13:19118529-19118551 CAGTATATGAATGCTGCTGAAGG + Intergenic
1107113523 13:36723036-36723058 CTGGACATTCATGCTCCAGCTGG + Intergenic
1109041201 13:57339334-57339356 ATGGATATTAATGTTTCTGTCGG + Intergenic
1110024863 13:70523802-70523824 CTGGATATTGTTTGTGCTGCTGG + Intergenic
1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG + Intergenic
1111439020 13:88253658-88253680 CAGGATCTTAATGCTGTTGAAGG + Intergenic
1112856976 13:103784689-103784711 CTGGATGTCAATGTTGCTGGTGG - Intergenic
1113317618 13:109199681-109199703 CTGGGGATTAAGGATGCTGCTGG - Intronic
1113474623 13:110571730-110571752 CTGGAAATAAATGAGGCTGCGGG + Intergenic
1119082111 14:71704761-71704783 CTGTATATTCATGCTGCTCGAGG - Exonic
1120105633 14:80490997-80491019 CCAGATAATACTGCTGCTGCAGG + Intronic
1122876528 14:104668726-104668748 TAGGATCTCAATGCTGCTGCAGG + Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1129129647 15:73482021-73482043 CTGGAGATAGATGGTGCTGCTGG - Intronic
1129517108 15:76163513-76163535 CTGCATATTCTTGGTGCTGCAGG - Intronic
1130087525 15:80790406-80790428 CTGAATATTAATGATGCTGATGG - Intronic
1131985512 15:98039706-98039728 CTTGAGATTCATGCTGCTGAAGG + Intergenic
1133949251 16:10376665-10376687 ATGAATATTAATCATGCTGCGGG + Intronic
1134619091 16:15674093-15674115 ATGGATGTTATTGCTGCAGCTGG + Intronic
1134619373 16:15676014-15676036 ATGGATGTTATTGCTGCAGCTGG + Intronic
1135959994 16:26987454-26987476 AGGGCTATTAATGCTGCTGGTGG + Intergenic
1138426512 16:56937106-56937128 TAGGAAATTAGTGCTGCTGCAGG + Intronic
1139457451 16:67093019-67093041 CAGGATATTAAGGCTGCAGTGGG - Intronic
1139844155 16:69907516-69907538 AAGGATATTAATGGTGCTGTGGG - Intronic
1143773667 17:9183995-9184017 ATGGACATTCATGCTGGTGCTGG + Intronic
1149959993 17:61098122-61098144 ATGGATATAAATGGTGCTGGAGG + Intronic
1151572215 17:74932504-74932526 CTGGACCTTAATGATTCTGCTGG - Intronic
1152559640 17:81071574-81071596 CTGGATATTTCTGTTGCTTCCGG - Intronic
1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG + Intronic
1155569986 18:27183072-27183094 CTAGAAATTAGTGCAGCTGCAGG - Intronic
1159981289 18:74783942-74783964 CTGGAAAATTATACTGCTGCTGG - Intronic
1161699304 19:5786282-5786304 CTGGAAATTGCTGCTGCTGTGGG - Intronic
1163712229 19:18853662-18853684 CTGGAGGTTAATGTGGCTGCAGG + Intronic
1164453365 19:28385924-28385946 CTGGTTTTGAAGGCTGCTGCGGG - Intergenic
927062438 2:19436519-19436541 TTATATTTTAATGCTGCTGCAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG + Intergenic
933262634 2:80147442-80147464 ATGGATATAAATGCTGTTGTTGG + Intronic
934850146 2:97693990-97694012 CTGGAGATGAATGCTGGTGATGG - Intergenic
936706647 2:115083076-115083098 CTGGATCTTTGTGCTTCTGCTGG + Intronic
944464082 2:199982839-199982861 TTTGTTATTATTGCTGCTGCAGG - Intronic
946954028 2:224908903-224908925 CTGAAAACCAATGCTGCTGCGGG - Intronic
947034359 2:225835225-225835247 CTAGATGTTAATGATTCTGCAGG - Intergenic
947689199 2:232119083-232119105 CTGGATATCATTATTGCTGCTGG + Intronic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1170467768 20:16638505-16638527 CTGGAAGTTCATACTGCTGCTGG + Intergenic
1173331780 20:42081298-42081320 CCAGATAATGATGCTGCTGCTGG + Intronic
1174160005 20:48543736-48543758 CTGAGTATTGAGGCTGCTGCTGG + Intergenic
1174279362 20:49427644-49427666 CTGGATATTAAGTCTGGTTCAGG + Intronic
1177539181 21:22469324-22469346 CTTGATAGTAATGCAGATGCAGG - Intergenic
1180763736 22:18229732-18229754 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1180771908 22:18394811-18394833 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1180803287 22:18644424-18644446 CTGGAATTTAAATCTGCTGCAGG - Intergenic
1180877272 22:19180442-19180464 CTGGACAGCAAGGCTGCTGCTGG - Intronic
1181218430 22:21350837-21350859 CTGGAATTTAAATCTGCTGCAGG + Intergenic
1181888126 22:26037805-26037827 CTGGAAATTATTCTTGCTGCTGG + Intergenic
1182254040 22:29025334-29025356 CTGGATATCAAAGGTGCTGGTGG - Intronic
1183058738 22:35322554-35322576 CTGGATATAAATGCTGCTTGTGG - Intronic
1203233745 22_KI270731v1_random:135801-135823 CTGGAATTTAAATCTGCTGCAGG - Intergenic
949357106 3:3192686-3192708 CTGGATGTGATTGCTGCTACAGG - Intergenic
951104820 3:18730511-18730533 CTGGGTATAAATGATGTTGCTGG - Intergenic
952467299 3:33603041-33603063 ATTGATGTGAATGCTGCTGCAGG - Exonic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
956160306 3:66344696-66344718 CTGGACATTACTTCAGCTGCTGG + Intronic
957352723 3:79047108-79047130 CTGGACGTTGAGGCTGCTGCTGG + Intronic
958621439 3:96567677-96567699 CTGGTTGTTAATGCTGCAGAGGG + Intergenic
960060803 3:113318014-113318036 CTGGGTATTAATGCAGCTACTGG + Intronic
963649607 3:147962156-147962178 ATGAAGATTTATGCTGCTGCTGG - Intergenic
964910247 3:161772248-161772270 CTGGCCATTGATGCTGCTGTTGG - Intergenic
971660666 4:29410591-29410613 CTGGATTGTAATACCGCTGCTGG + Intergenic
973305584 4:48645420-48645442 GTGGATATTAATGCTGGAGTTGG - Intronic
974712709 4:65621640-65621662 CTGTATATTAATGTTTCTCCTGG - Intronic
974818594 4:67037077-67037099 CTGAATATTAATTCTGCTCTAGG - Intergenic
975620468 4:76291311-76291333 CTGGGCATGGATGCTGCTGCTGG - Intronic
976959788 4:90956230-90956252 CTGTATAATAATGCTTCTGTAGG - Intronic
985124059 4:186673991-186674013 CTGTATCTTAATGCTTCTGAAGG - Intronic
985909884 5:2870849-2870871 CTGGATAGCAATGATGGTGCAGG + Intergenic
985922331 5:2987325-2987347 TGGGATATTGATGCTTCTGCAGG - Intergenic
989387694 5:40869617-40869639 CTGAATGTTCATGCTGATGCTGG + Intergenic
993486889 5:88497779-88497801 CTGGGTATGAGTGCTGATGCAGG - Intergenic
995229400 5:109741722-109741744 TTGAATAATAATGCTGCTGGGGG - Intronic
995525820 5:113049824-113049846 CTGGAGGTTGATGCTGCTGCAGG - Intronic
996691711 5:126347465-126347487 CTGGATCTAAATGCTGTTGTAGG - Intergenic
1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG + Intronic
1002336966 5:178486366-178486388 CTGGATCTTACTTATGCTGCAGG - Intronic
1002567119 5:180118501-180118523 CTGTCTATTACTGATGCTGCAGG + Intronic
1008428032 6:51381568-51381590 CCGGGTATTACTGATGCTGCTGG + Intergenic
1008538172 6:52523702-52523724 CTGGAAATTTATCCTGCAGCTGG + Intronic
1012031783 6:94078867-94078889 ATGGATATTAAAGCTACTGTAGG + Intergenic
1013754867 6:113449291-113449313 GTGTAAATTAATGCTGCTTCTGG + Intergenic
1014645408 6:123966766-123966788 CTGTATACTACTACTGCTGCAGG + Intronic
1019078240 6:169409071-169409093 CTGGATATAAATGGTGGTGATGG - Intergenic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1023337975 7:39189734-39189756 CTGAATAATAATTCTTCTGCAGG - Intronic
1024177257 7:46853274-46853296 CTGGATATTAATCCTGTATCTGG + Intergenic
1026009579 7:66626459-66626481 CAGGATAATTATGATGCTGCTGG - Intergenic
1027967354 7:85029026-85029048 CTTGATATTAAAACTGCTGATGG + Intronic
1029474179 7:100773342-100773364 CGGGTTGTTTATGCTGCTGCAGG - Exonic
1030566568 7:111164994-111165016 CTGGATATGAATGGTGGTGATGG - Intronic
1037267271 8:17078017-17078039 CTGGGTATTAATGTTGCTCTTGG + Intronic
1037330440 8:17738703-17738725 TTGAAAATTAATGCTGCTTCAGG - Intronic
1038704649 8:29882186-29882208 CTGGATACAAATGCTACTGCTGG + Intergenic
1041678627 8:60563365-60563387 CGTGATACTGATGCTGCTGCTGG - Intronic
1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG + Intronic
1046066664 8:109205374-109205396 CTGCATCTTGATTCTGCTGCTGG - Intergenic
1048349981 8:133608309-133608331 CTGGGTATGAATGGTCCTGCAGG - Intergenic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1053587728 9:39477967-39477989 ATGGATTTTAATGCTTCTGAAGG + Intergenic
1054578572 9:66887278-66887300 ATGGATTTTAATGCTTCTGAAGG - Intronic
1055026722 9:71729852-71729874 CTGATTAATAATGCAGCTGCAGG - Exonic
1055653820 9:78434317-78434339 TTGGATATTATTGCTACCGCAGG - Intergenic
1056914777 9:90736632-90736654 ATGGATGTTAAAGGTGCTGCTGG + Intergenic
1059851371 9:118344652-118344674 CAGGATATTAATTCTTCAGCAGG - Intergenic
1060185594 9:121562190-121562212 CTGGGAATTCCTGCTGCTGCTGG + Intergenic
1185856869 X:3544145-3544167 CTGGACATGAATCCTGCTGCTGG - Intergenic
1186712441 X:12213502-12213524 CAGGATATTAATGCTGCTTTTGG - Intronic
1188961505 X:36498376-36498398 ATGGATATGGATGCAGCTGCAGG + Intergenic
1189174955 X:38947135-38947157 CTGGACACTAATGCTGCTGAAGG + Intergenic
1190635041 X:52425016-52425038 CTTGCTGTTACTGCTGCTGCAGG - Intergenic
1195676258 X:107509301-107509323 CTGGATCTCAATGCATCTGCTGG + Intergenic
1198670726 X:139077526-139077548 CTGGATATTTATGCTGTGCCTGG - Intronic
1199541926 X:148967031-148967053 CCGGACATTAGTGCTGCTGCTGG - Exonic
1200807357 Y:7446309-7446331 CTGGACATGAATCCTGCTGCTGG + Intergenic