ID: 955091213

View in Genome Browser
Species Human (GRCh38)
Location 3:55752455-55752477
Sequence CTGGTTTACCAGCGCTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955091210_955091213 7 Left 955091210 3:55752425-55752447 CCAATCAGGGATTTTGTTTTTTC 0: 1
1: 0
2: 4
3: 72
4: 632
Right 955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955091213 Original CRISPR CTGGTTTACCAGCGCTCTAT TGG Intronic
905847411 1:41243855-41243877 CTGTTTTGCCAGCTCTCTGTTGG + Intergenic
914048839 1:144114664-144114686 CAGGTTTACAAGCGGTCTCTGGG + Intergenic
914130345 1:144850784-144850806 CAGGTTTACAAGCGGTCTCTGGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG + Intergenic
1074872872 10:117590847-117590869 GTGGTTTGCCAGGGCTCTTTAGG - Intergenic
1085514022 11:77102081-77102103 CTGGTTTATCAGGGCTCTGTGGG - Intronic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1112690886 13:101892678-101892700 CTGTTTTCCCAGCACACTATGGG - Intronic
1116776744 14:49189940-49189962 TTGGTTTTCCAGAGCTCTGTTGG - Intergenic
1119006068 14:70930654-70930676 CTGGTTTACAAGTGAGCTATTGG - Intronic
1123418778 15:20114267-20114289 CAGGTTTACAAGCGGTCTCTGGG + Intergenic
1123527996 15:21120806-21120828 CAGGTTTACAAGCGGTCTCTGGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1131766212 15:95678269-95678291 CTGGGTTACCAGTACTCTCTTGG + Intergenic
1133309625 16:4835854-4835876 CCAGCTTACCAGAGCTCTATGGG + Intronic
1203138343 16_KI270728v1_random:1744524-1744546 CAGGTTTACAAGCGGTCTCTGGG - Intergenic
1164934020 19:32197276-32197298 CTGGTTTGCCAGGGCTTTCTGGG - Intergenic
1202688290 1_KI270712v1_random:67567-67589 CAGGTTTACAAGCGGTCTCTGGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
931704244 2:64934038-64934060 CTGGTTGACCAGCACTCCCTGGG - Intergenic
945638434 2:212389507-212389529 CTGGTCAATCAGCACTCTATGGG + Intronic
947562611 2:231170554-231170576 CTGTGTTTCCAGCTCTCTATTGG + Exonic
1172867733 20:38112881-38112903 CTGGTTTATCAGCAGTCTCTGGG - Intronic
1181350888 22:22256996-22257018 CAGGTTTACAAGCGGTCTCTGGG + Intergenic
954703483 3:52465468-52465490 CTTGTTTACCAGCCCACTTTAGG + Intronic
955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG + Intronic
963852870 3:150225287-150225309 CTGGTTTACCAGCATACTTTTGG - Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
991917850 5:71622941-71622963 CTGGTTTTCCTTCGCTCTCTGGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1002823277 6:749066-749088 CTGGTTTACCAGGACAATATTGG + Intergenic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1034679884 7:152920534-152920556 CTGGTTTTCCATCTTTCTATTGG - Intergenic
1037597862 8:20369465-20369487 CTGGCTTTCCAGCTCACTATGGG + Intergenic
1048282671 8:133116559-133116581 CTGGTTAAACATGGCTCTATGGG - Intronic
1052352051 9:27467962-27467984 CTTGTTTATTAGGGCTCTATTGG + Intronic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1194213818 X:91103106-91103128 CTGCTTTATCAACTCTCTATAGG - Intergenic
1197074088 X:122334979-122335001 CTGGTTTACCAGCACAGTACTGG - Intergenic