ID: 955091217

View in Genome Browser
Species Human (GRCh38)
Location 3:55752503-55752525
Sequence TTGCCAAGACTGCTGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955091212_955091217 26 Left 955091212 3:55752454-55752476 CCTGGTTTACCAGCGCTCTATTG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG 0: 1
1: 0
2: 2
3: 21
4: 484
955091214_955091217 17 Left 955091214 3:55752463-55752485 CCAGCGCTCTATTGGCCTGTTTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG 0: 1
1: 0
2: 2
3: 21
4: 484
955091215_955091217 2 Left 955091215 3:55752478-55752500 CCTGTTTCAAGATAATTGAACAG 0: 1
1: 0
2: 2
3: 12
4: 163
Right 955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG 0: 1
1: 0
2: 2
3: 21
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955091217 Original CRISPR TTGCCAAGACTGCTGAACAA GGG Intronic
900072923 1:788325-788347 TTGCCCAGACTGCAGTGCAATGG - Intergenic
900283019 1:1884003-1884025 TTGCCCAGGCTGCAGTACAATGG + Intronic
900844781 1:5088334-5088356 TTGCCCAGGCTGCAGTACAATGG - Intergenic
900952297 1:5864868-5864890 TTGCCAGGAATTCTGAACACCGG + Intronic
901290619 1:8121426-8121448 TTGCCAAGGCTACTGAACAAAGG - Intergenic
902080136 1:13815144-13815166 TTGCCCAGGCTGGTGTACAATGG + Intronic
902347866 1:15832254-15832276 TTGCCCAGACTGGAGTACAATGG + Intergenic
904149296 1:28424229-28424251 TTGCCCAGACTGGAGTACAATGG + Intronic
905559067 1:38912009-38912031 TTGCCCAGGCTGCAGTACAATGG + Intronic
905611021 1:39351624-39351646 TTGCCAAGACTGGAGTACAGTGG + Intronic
906388688 1:45394729-45394751 TTGCCCAGGCTGCAGTACAATGG + Intronic
906969548 1:50496847-50496869 TTGCCCAGACTGGAGTACAATGG - Intronic
909225595 1:73017352-73017374 TTGCCCAGGCTGCAGTACAATGG - Intergenic
909408640 1:75322270-75322292 TTGCCCAGACTGCAGTACAGGGG - Intronic
909772075 1:79436380-79436402 TTGCCCAGACTGCAGTGCAATGG + Intergenic
910059188 1:83068330-83068352 TTGCCCAGACTGGAGTACAACGG + Intergenic
910573349 1:88730479-88730501 TTGCCAAGAATGCAGACCCAAGG - Intronic
910923431 1:92373877-92373899 TTGCCCAGACTGGAGTACAATGG - Intronic
912578598 1:110699591-110699613 TTGGCAAGAATGCTGAGAAAAGG + Intergenic
912837383 1:113008676-113008698 TTGCCAAGACTGGAGTGCAATGG + Intergenic
912866159 1:113258641-113258663 TGGCCAAGATTGATGAGCAATGG - Intergenic
912992606 1:114504202-114504224 TTGCCAAGGCTGGAGTACAATGG + Intronic
912999769 1:114568404-114568426 TTGCCCAGGCTGGAGAACAATGG + Intronic
914257045 1:145969136-145969158 TTGCCCAGACTGGTGCACAGTGG + Intronic
914714966 1:150246942-150246964 TTGCCCAGGCTGCAGTACAATGG - Intergenic
915895214 1:159806739-159806761 TGGCCAAGACTCCTGAGGAAGGG - Intronic
917276357 1:173335892-173335914 TTTCCAGGACTACTGAACACTGG + Intergenic
917809715 1:178646489-178646511 TTGCCCAGACTGGCGTACAATGG - Intergenic
918765398 1:188475937-188475959 TTGGCAAGACTGCAGAGAAAAGG - Intergenic
919102414 1:193110737-193110759 TTGCCCAGACTGGAGAACAGTGG - Intergenic
919541493 1:198851205-198851227 TTGCCAAGGCTGGAGAGCAATGG - Intergenic
919668908 1:200320747-200320769 TTGCCCAGGCTGGTGTACAATGG - Intergenic
920090128 1:203446811-203446833 TTGACTAAACTGCTGCACAAAGG + Intergenic
920281692 1:204848213-204848235 TTGCCAAAAGTGATGAAAAAGGG - Intronic
921565476 1:216712306-216712328 GTGCCAAGACTGCACAATAATGG + Intronic
922175212 1:223192089-223192111 TTGCCCAGACTGGAGTACAATGG + Intergenic
922268513 1:224011258-224011280 TTGCCCAGACTGCAGTGCAATGG - Intergenic
923071949 1:230573628-230573650 TTGCCCAGACTGGAGTACAATGG - Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG + Intergenic
923753278 1:236766828-236766850 TTGCAAAGACTGTTAAATAAAGG - Intergenic
923906375 1:238389693-238389715 TTTCCAGGACTGCTGAGAAAGGG + Intergenic
924093947 1:240531746-240531768 TTGCCCAGACTGGAGAGCAATGG + Intronic
1063002121 10:1933909-1933931 TTGCCCAGACTGGAGCACAATGG - Intergenic
1064072059 10:12238948-12238970 TTGCCCAGGCTGCAGCACAATGG - Intronic
1064130541 10:12705708-12705730 TTGGCAAGAAGGCCGAACAATGG - Intronic
1064700415 10:18013405-18013427 TTGCCCAGGCTGCAGAACAGTGG + Intronic
1064999071 10:21320724-21320746 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1065028783 10:21564594-21564616 TAGCCAAAACTGATGAACAGAGG - Intronic
1066677854 10:37907356-37907378 TTGCCCAGACTGGAGTACAATGG + Intergenic
1067855392 10:49788120-49788142 TTGCCCAGACTGGAGTACAATGG - Intergenic
1067880310 10:50038230-50038252 TTGCCCAGACTGGAGTACAATGG + Intergenic
1068513655 10:57998303-57998325 CTGCCAAGACTGGTGAAGTAGGG + Intergenic
1068706755 10:60085653-60085675 TTGCCAAGACTGGAGTGCAATGG + Intronic
1069423468 10:68268585-68268607 TTGCCCAGACTGGAGTACAATGG - Intergenic
1070010308 10:72467221-72467243 TTGCCCAGACTGGAGTACAATGG + Intronic
1070854633 10:79596895-79596917 TTGCCCAGACTGGAGTACAATGG - Intergenic
1071356556 10:84802181-84802203 TGGCCAAGACAGATCAACAAAGG - Intergenic
1072239919 10:93486390-93486412 TTGACAAGAATGTGGAACAACGG + Intergenic
1072963160 10:99948921-99948943 TTGCCCAGACTGCAGTGCAATGG - Intronic
1073409365 10:103327243-103327265 TTGCCCAGACTGGAGTACAATGG - Intronic
1073681018 10:105703444-105703466 TTGCCAAGACTGGGGTACACTGG - Intergenic
1074003872 10:109399348-109399370 TTGCCCAGACTGGAGAGCAATGG - Intergenic
1074589080 10:114795667-114795689 TTGCCCAGACTGGAGTACAATGG - Intergenic
1076227349 10:128790473-128790495 TTGCCCAGACTGGAGAGCAATGG + Intergenic
1077539959 11:3141950-3141972 TTGCCCAGACTGGAGTACAATGG + Intronic
1078153612 11:8779550-8779572 TTGCCCAGGCTGCAGTACAATGG + Intronic
1080697447 11:34615249-34615271 TTGCCCAGACTGGAGTACAATGG + Intergenic
1081186733 11:40052275-40052297 TTCCCCAAACTCCTGAACAATGG + Intergenic
1081760747 11:45575085-45575107 TTGCCAAGACTTTTGAGCACTGG - Intergenic
1082064463 11:47888211-47888233 TTGCCAAGGCTGCTGGTCCATGG - Intergenic
1082860851 11:57855007-57855029 TTGCCCAGGCTGCAGAGCAATGG + Intergenic
1082925873 11:58546735-58546757 TTCCCAATACTGCTGATCCATGG - Intronic
1083578393 11:63809221-63809243 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1085025135 11:73232008-73232030 TTGCCAAGGCTGGAGTACAATGG - Intronic
1085171179 11:74451315-74451337 TTGCCCAGACTGGAGTACAATGG + Intergenic
1085327400 11:75617474-75617496 TTGCCCAGACTGCAGCACAGAGG - Intronic
1085569072 11:77543376-77543398 TTGCCAAGACTGGAGTTCAATGG - Intronic
1085902524 11:80718748-80718770 TTTCCAAGCTTACTGAACAATGG - Intergenic
1086297031 11:85380618-85380640 TTGCCCAGGCTGCAGAGCAATGG - Intronic
1086958892 11:92962085-92962107 TTGCCTAGACTGCAGTGCAATGG + Intergenic
1087632569 11:100667939-100667961 TTAGAAAGACTGATGAACAAAGG + Intergenic
1087754991 11:102046059-102046081 TTGGCAAGGATGTTGAACAACGG + Intergenic
1087836819 11:102883366-102883388 TTGCCAAATCTGCTCAACTAGGG + Intergenic
1089249480 11:117147226-117147248 TTGCCCAGACTGGAGTACAACGG - Intronic
1089483912 11:118829983-118830005 TTGCCCAGACTGGAGCACAATGG - Intergenic
1089671427 11:120059746-120059768 TTGCAATGGCTGATGAACAAAGG - Intergenic
1090943977 11:131413423-131413445 TTGCGAACAGTGCTGATCAATGG + Intronic
1091497265 12:983454-983476 TTGCCCAGACTGGAGAGCAATGG + Intronic
1091514234 12:1162166-1162188 TGGCCAAGCGTGCTGTACAATGG + Intronic
1092134216 12:6134903-6134925 TTGCCCAGACTGTTGTGCAATGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1093557508 12:20493668-20493690 TTGCCAAGGCTGCAGTACAATGG + Intronic
1093935392 12:24995221-24995243 TTGCCCAGACTGGTGTGCAATGG + Intronic
1094318771 12:29161761-29161783 TTGACAAGAATGTGGAACAAGGG - Intronic
1095434554 12:42173130-42173152 TTGCCCAGACTGCAGTGCAATGG + Intronic
1095819884 12:46466437-46466459 TTGCCATGGCTTCTGAACACTGG + Intergenic
1096041910 12:48525074-48525096 TTGCCCAGACTGGAGTACAATGG + Intronic
1096802686 12:54121777-54121799 TTCCCAAGACTGCTGATCTTGGG - Intergenic
1098673747 12:73264094-73264116 TTGAAAAGACAGCTGTACAATGG + Intergenic
1098931275 12:76418053-76418075 TTGCCCAGGCTGCTGTGCAATGG + Intronic
1099056402 12:77846865-77846887 TTGCCAACACTGGTTAAAAATGG - Intronic
1100630461 12:96384259-96384281 TTGGCAAGACTGCAGAGAAAAGG + Intronic
1101396015 12:104348440-104348462 TTGCCAAGACTGCAAACCACTGG + Exonic
1103419908 12:120772059-120772081 TTGCCCAGGCTGCAGTACAATGG + Intronic
1103766654 12:123285101-123285123 TTGCCCAGGCTGCTGTGCAATGG + Intergenic
1104233822 12:126911983-126912005 TTGCCCAGACTGGGCAACAATGG - Intergenic
1104916135 12:132265578-132265600 TTGCGAAGCCTGCTGCAAAAGGG - Intronic
1105313085 13:19230555-19230577 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1105364831 13:19755194-19755216 TTGCCCAGACTGCAGTGCAATGG - Intronic
1105971902 13:25436741-25436763 TTGGCAAGGCTGCAGAAAAAGGG - Intronic
1106370066 13:29123666-29123688 TTGCCCAGACTGGAGAACAATGG - Intronic
1107325093 13:39233252-39233274 TTGCCAAGAATGATGATTAAAGG + Intergenic
1107556075 13:41517679-41517701 TTGGCAAGACTGCTGCTCAGAGG + Intergenic
1107936623 13:45350811-45350833 TTGCCAAGGCTGCAGTACAGTGG - Intergenic
1107936889 13:45352793-45352815 TTGCCCAGACTGGTGTGCAACGG + Intergenic
1108039585 13:46327117-46327139 TTGCCAAGACTAATGACCACTGG - Intergenic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1108499989 13:51061031-51061053 TGGCCAAGACTGCACAGCAAGGG - Intergenic
1108704059 13:52969069-52969091 TTGCCAAGCCCCCTCAACAATGG - Intergenic
1110094308 13:71497369-71497391 TTGCCCAGACTGGAGTACAATGG + Intronic
1110239726 13:73253886-73253908 TTGCCCAGACTGGAGCACAATGG - Intergenic
1110864634 13:80380331-80380353 TTGCCAAGGCTGGAGTACAATGG - Intergenic
1110874923 13:80497139-80497161 CTTCCAAGACTGCAGATCAATGG + Intergenic
1111048811 13:82851458-82851480 TTGCCCAGACTGCAGTGCAATGG + Intergenic
1111333876 13:86794594-86794616 TTGCCAAGGCTGGTGTGCAATGG - Intergenic
1111356635 13:87114821-87114843 TTGCCAAGACTGGAGTGCAATGG + Intergenic
1112681981 13:101777387-101777409 TTACCAAGACTGCTCAACAAAGG - Intronic
1114429960 14:22652327-22652349 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1114451423 14:22828931-22828953 TTGCCCAGACTGGAGTACAATGG + Intronic
1114467742 14:22936198-22936220 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1115983087 14:39075065-39075087 TTGCCCAGACTGGAGTACAATGG - Intronic
1116244766 14:42395382-42395404 TTGCCAAGATTGCTGGAGATGGG + Intergenic
1118196855 14:63634828-63634850 TTGCCCAGACTGCAGTGCAATGG - Intronic
1118565887 14:67140342-67140364 TTGCCCAGACTGGAGTACAATGG - Intronic
1118676147 14:68186720-68186742 TTGGCAAGACTGCAGAGAAAAGG + Intronic
1118782360 14:69017346-69017368 TTGCCCAGGCTGCAGAGCAATGG - Intergenic
1119949273 14:78727693-78727715 TTGCCCAGGCTGCAGTACAATGG - Intronic
1121262389 14:92575969-92575991 TGGCCAAGGTTGCTGAAGAAAGG - Intronic
1121528899 14:94638891-94638913 TTGCCCTGACTGCTGAATATTGG + Intergenic
1121636911 14:95460242-95460264 TTGCCTAGACTGGAGTACAATGG + Intronic
1121875646 14:97448904-97448926 CTCCCAACACTGGTGAACAAAGG + Intergenic
1122705172 14:103616360-103616382 TTGCCCAGGCTGGTGTACAATGG - Intronic
1122915755 14:104857857-104857879 TTGCCCAGACTGAAGTACAATGG + Intergenic
1124471654 15:29992339-29992361 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1124920448 15:34021323-34021345 TTGCCCAGACTGGAGTACAATGG + Intronic
1125292989 15:38170402-38170424 TTGCCCAGACTGGAGTACAATGG + Intergenic
1125497989 15:40215430-40215452 TTGCCCAGACTGGAGTACAATGG - Intronic
1125558467 15:40606797-40606819 TTGCCCAGACTGGAGTACAATGG + Intronic
1126531371 15:49714485-49714507 TTGCCCAGACTCCTGATCCATGG - Intergenic
1126623399 15:50663166-50663188 TTGCCCAGACTGGAGAGCAATGG + Intronic
1126654578 15:50963101-50963123 TTGCCAAGGATGCAGAAAAAAGG + Intronic
1127105024 15:55604502-55604524 TTGCCCAGACTGGAGTACAATGG - Intergenic
1127225607 15:56925160-56925182 TTGCCAAGACTGGAGTACACTGG - Intronic
1128405877 15:67338019-67338041 TCACAAAGATTGCTGAACAATGG - Intronic
1128843517 15:70870528-70870550 TTGCCAAGGCTGTAGAGCAATGG + Intronic
1129047122 15:72745410-72745432 TTGCCCAGACTGATGTGCAATGG - Intergenic
1129357822 15:75003942-75003964 TTGCCCAGGCTGCAGAGCAATGG + Intronic
1129440273 15:75576490-75576512 TTGCCCAGACTGGAGTACAATGG - Intronic
1129769061 15:78192181-78192203 TTGCCAAGGCTGCTGGAAAAGGG - Intronic
1130809391 15:87360548-87360570 TAGCCAAGGCTGCTGAGAAATGG - Intergenic
1130852837 15:87814391-87814413 TTGGCAAGACTGTGGAACAATGG + Intergenic
1132492477 16:240540-240562 TTGCCAAGGCTGGAGTACAATGG + Intronic
1132780806 16:1624190-1624212 TTGCCCAGACTGGTGTGCAATGG + Intronic
1134309769 16:13065187-13065209 TTGCCAAGGATGCAAAACAAGGG - Intronic
1135180964 16:20274121-20274143 TTGCCCAGGCTGATAAACAAAGG - Intergenic
1135677512 16:24429754-24429776 TTGCCCAGGCTGGAGAACAATGG + Intergenic
1137877741 16:52013444-52013466 TTGCTAAGACTGTTGGAAAAGGG + Intronic
1139912941 16:70409381-70409403 TTGCCCAGACTGGAGTACAATGG + Intronic
1140061353 16:71572628-71572650 TGGCCAACACAGCTAAACAAAGG + Exonic
1140393833 16:74610465-74610487 TTGCCCAGGCTGCTGTGCAATGG + Intergenic
1140433594 16:74926097-74926119 TTGCCCAGGCTGGAGAACAATGG + Intronic
1140520300 16:75575333-75575355 TTGCCCAGGCTGCAGTACAATGG + Intronic
1141956070 16:87372182-87372204 TTGCCTAGACTGCAGTGCAATGG - Intronic
1143526097 17:7473584-7473606 TTGCCCAGGCTGCAGTACAATGG + Intronic
1143623363 17:8093821-8093843 TTGCCCAGACTGGAGTACAATGG - Intergenic
1145225149 17:21122489-21122511 ATGCCAACACAGCCGAACAAGGG - Intergenic
1147895392 17:43747676-43747698 TTGCCCAGACTGCAGTACAGTGG - Intergenic
1148380356 17:47192312-47192334 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1148643225 17:49203862-49203884 TTGCCCAGGCTGGTGTACAATGG - Intronic
1148803678 17:50251975-50251997 TTGCCCAGGCTGGTGTACAATGG + Intergenic
1149081831 17:52667104-52667126 TTGCCAAGGCTGGAGTACAATGG + Intergenic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1149802892 17:59587261-59587283 TTGCCCAGACTGGAGTACAATGG + Intronic
1149843594 17:59988217-59988239 TTGCCCAGACTGGAGTACAATGG - Intergenic
1150163597 17:62920060-62920082 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1150349016 17:64428107-64428129 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1152240977 17:79160938-79160960 TTGCCGAGACTGGAGTACAATGG - Intronic
1153303243 18:3610016-3610038 TTGCCCAGGCTGGAGAACAATGG - Intronic
1155049891 18:22137825-22137847 TTGCCCAGACTGGAGTACAATGG + Intergenic
1155209738 18:23590162-23590184 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1157702415 18:49770690-49770712 TTGCCAAGGCTGGAGTACAATGG + Intergenic
1158022135 18:52855803-52855825 TTGCCCAGACTGGAGTACAATGG + Intronic
1158114748 18:53982707-53982729 TTGCCTAGGCTGCAGTACAATGG - Intergenic
1158273005 18:55736787-55736809 TTGCCAAGGCTGCAGTGCAATGG - Intergenic
1158694148 18:59688404-59688426 TTGCCTAGACTGCAGTACAGTGG - Intronic
1159593194 18:70356967-70356989 TTGCCCAGACTGGAGTACAATGG - Intergenic
1159680509 18:71344988-71345010 TTGCCCAGACTGGAGTACAAGGG - Intergenic
1159787513 18:72731398-72731420 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1160111149 18:76033012-76033034 TTGCCCAGACTGGAGTACAATGG + Intergenic
1160961586 19:1724219-1724241 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1161182231 19:2891669-2891691 TTGCCCAGACTGGAGTACAATGG - Intergenic
1161416153 19:4147836-4147858 TTGCCCAGACTGGAGTACAATGG - Intergenic
1161503626 19:4632017-4632039 TTCACAAGACGGCTGGACAAAGG + Intergenic
1162285676 19:9736944-9736966 TTGCCCAGACTGGAGCACAATGG + Intergenic
1162429152 19:10616780-10616802 TTGCCAAGGCTGTAGTACAATGG + Intronic
1162556114 19:11386891-11386913 TTGCCCAGGCTGCAGTACAATGG + Intronic
1162627456 19:11896177-11896199 TTGCCAAGGCTGGAGAGCAATGG - Intronic
1163852666 19:19674214-19674236 TTGCCCAGACTGGAGTACAATGG + Intronic
1165470188 19:35998939-35998961 TTGCCCAGACTGGAGTACAATGG - Intergenic
1165602974 19:37073703-37073725 TCGCCAAGACTGCAGTACAGTGG - Intronic
1166083356 19:40458731-40458753 TTGCCCAGGCTGCTGTGCAATGG + Intronic
1166912506 19:46169806-46169828 TTGCCTAGACTGCAGTGCAATGG - Intergenic
1166936560 19:46336945-46336967 TTGCCCAGGCTGCAGTACAATGG - Intronic
1167678509 19:50904822-50904844 TTGCCCAGACTGCTGTGCAGTGG + Intergenic
1168563336 19:57402160-57402182 GTGCCAAGACTACTCAACAGAGG - Intronic
1168586146 19:57594393-57594415 TTGCCAAGACTCATGACCATTGG - Intergenic
926243481 2:11105194-11105216 TTCCCAAGGCTGCTCATCAATGG - Intergenic
926377201 2:12243741-12243763 TTGCCAAGACTTGTGACCACTGG + Intergenic
927549321 2:23983465-23983487 TTGCCCAGACTGGAGAGCAATGG - Intronic
928398540 2:30961719-30961741 TTGCCAAGACTGGAGTGCAATGG + Intronic
929482595 2:42324577-42324599 TTGCCAAGGCTGGAGTACAATGG - Intronic
931501130 2:62868337-62868359 TTGCCCAGGCTGCAGTACAATGG - Intronic
931569258 2:63650927-63650949 TTGCCAAGAAGGCTGAAAGATGG + Intronic
931680192 2:64740135-64740157 TTGCCCAGACTGGAGTACAATGG - Intronic
932494225 2:72138564-72138586 CAGCCAAGAATGCTGGACAAAGG + Intronic
933148141 2:78881494-78881516 TTGCCAAGACTGTTGGAGCATGG - Intergenic
933662266 2:84937429-84937451 TTGCCCAGACTGGAGGACAATGG - Intergenic
933794425 2:85908122-85908144 CTGCCAAGACTGCTGAACTTTGG - Intergenic
934744441 2:96749753-96749775 TTGCCCAGGCTGGTGTACAATGG - Intergenic
935253538 2:101287281-101287303 TTGCCCAGACTGGAGTACAAGGG - Intronic
935688603 2:105709949-105709971 TTGCAAAGATTGCAGAAGAAGGG - Intergenic
935877598 2:107528229-107528251 TTGCCAAGGCTGCAGAGAAAAGG + Intergenic
936464926 2:112739379-112739401 TTGCCCAGACTGGAGTACAATGG - Intronic
936697451 2:114967000-114967022 TTGCCCAGACTGGTGTACAATGG - Intronic
936798000 2:116230603-116230625 TTGCCCAGACTGGAGAACACTGG + Intergenic
937278282 2:120700386-120700408 TTGCCCAGACTGGAGTACAATGG + Intergenic
938078670 2:128356841-128356863 GTGCCAAGACAGTTAAACAAAGG - Intergenic
938814271 2:134883695-134883717 TTGCCCAGACTGGTCAACATAGG + Intronic
938858139 2:135337271-135337293 GTGCCAAGCATGCTGAAGAAAGG - Intronic
939224245 2:139344900-139344922 TTGCCCAGACTGGAGAACAGTGG - Intergenic
940211468 2:151260163-151260185 TTGCCCAGGCTGGAGAACAATGG + Intronic
940896637 2:159087545-159087567 TTGCCCAGGCTGCTGTACAGTGG + Intronic
941116431 2:161477725-161477747 TTGCCCAGACTGCAGTGCAATGG - Intronic
942038447 2:172034035-172034057 TTGCCCAGACTGGAGTACAATGG - Intronic
942711517 2:178841682-178841704 TTGCCAAGACTGGAGTGCAATGG + Intronic
942936396 2:181561851-181561873 TTGCCCAGGCTGGAGAACAATGG + Intronic
943102601 2:183506749-183506771 TTGCCCAGAATGCTGCACAAAGG - Intergenic
943495863 2:188620014-188620036 ATGTCAAGACAGCTGAATAAAGG - Intergenic
943817927 2:192279530-192279552 TTGCCCAGACTGATGTACAGGGG - Intergenic
944248914 2:197561473-197561495 TTGCCCAGACTGCAGTGCAATGG + Intergenic
945407067 2:209461493-209461515 TTGCCCAGACTGCAGTGCAATGG + Intronic
945980335 2:216304912-216304934 TTGCCCAGACTGGAGTACAATGG - Intronic
946664438 2:222034526-222034548 TTGCCCAGCCTGGTGTACAATGG + Intergenic
946719043 2:222584650-222584672 TTGCTAAGACTGTTGGAAAAGGG - Intronic
947302225 2:228700773-228700795 TTGCCCAGGCTGCAGTACAATGG - Intergenic
947428456 2:230004964-230004986 TTGCCAAGACTGGAGTGCAATGG - Intronic
947962895 2:234254483-234254505 TTGCCAAGACTGGAGTGCAATGG + Intergenic
948448199 2:238050321-238050343 TTGCCCAGACTGGAGAACAATGG + Intronic
948926806 2:241104108-241104130 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169344404 20:4819000-4819022 TTGCCAAGGCTGGAGCACAATGG + Intronic
1169685513 20:8266995-8267017 TTGCCCAGACTGGAGTACAATGG - Intronic
1170105551 20:12751134-12751156 TTGCCAAGCCTGGGCAACAAGGG - Intergenic
1172325586 20:34032000-34032022 TTGCCCAGACTGCAGTGCAATGG + Intronic
1172522923 20:35579883-35579905 TTGCCCAGACTGCAGTACAGTGG - Intergenic
1173804539 20:45915491-45915513 TTGCCCAGACTGCTGTGCAGTGG + Intergenic
1173917820 20:46722472-46722494 TTGCCAAGACTTGTGACCACTGG + Intronic
1174601404 20:51727889-51727911 TTGCCCAGGCTGGTGCACAATGG - Intronic
1174827321 20:53780314-53780336 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1175144642 20:56886332-56886354 TTGCCAATGTTGCTGTACAAGGG + Intergenic
1175509042 20:59509449-59509471 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1175594337 20:60218450-60218472 TTGCCAAGACTGGAGTACAGTGG - Intergenic
1176427300 21:6556579-6556601 ATGCCTGGACTGCTGAACCATGG - Intergenic
1177321816 21:19531579-19531601 TTGCCCAGACTGCAGCGCAATGG - Intergenic
1177594288 21:23215429-23215451 TTGCCAAGACTCATGACCACTGG - Intergenic
1178123182 21:29490275-29490297 TTTCAAAAACTTCTGAACAATGG - Intronic
1178155661 21:29851092-29851114 TTGCCCAGACTGGAGTACAATGG + Intronic
1178408033 21:32340571-32340593 TTGCCCAGACTGGAGTACAATGG - Intronic
1179702791 21:43164896-43164918 ATGCCTGGACTGCTGAACCATGG - Intergenic
1180212960 21:46306625-46306647 TTGCCCAGACTGCAGTACAGTGG + Intronic
1181563744 22:23721243-23721265 TTGCCCAGACTGGAGAGCAATGG + Intergenic
1182139609 22:27942378-27942400 TTGCCCAGACTGCAGTGCAATGG + Intergenic
1182821120 22:33217026-33217048 TTGGCAAGAATGTGGAACAATGG + Intronic
1182873345 22:33668000-33668022 TTGGCAAGACAACTGAAAAATGG - Intronic
1182920567 22:34075467-34075489 TAGCCAAAGATGCTGAACAAAGG + Intergenic
1183452076 22:37902077-37902099 TTGCCCAGACTGGAGGACAATGG + Intergenic
1183709939 22:39497181-39497203 TTGCCAAGACTGGAGTGCAATGG + Intergenic
1183910104 22:41072523-41072545 TTGCCAAGACTGGAGTGCAATGG - Intergenic
1184297550 22:43534579-43534601 TTGCCCAGACTGGAGAACAGTGG - Intronic
1184718260 22:46294329-46294351 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1185125968 22:49011018-49011040 TTGCCCCGAGGGCTGAACAAAGG + Intergenic
949400220 3:3657830-3657852 TTCACAAGACCGCTGAAAAAAGG + Intergenic
950037499 3:9897650-9897672 AAGCCAACACTGCTCAACAAGGG - Intergenic
951531095 3:23698647-23698669 TTGCCCAGACTGGAGTACAATGG - Intergenic
952069638 3:29618464-29618486 TTGCCAAGGCTGTAGTACAATGG - Intronic
952736845 3:36699216-36699238 TTGCCCAGACTGGAGTACAATGG - Intergenic
952760521 3:36909375-36909397 TTGGTAAGTGTGCTGAACAAAGG + Intronic
953353329 3:42232263-42232285 TTGCCCAGACTGGAGCACAATGG - Intergenic
953696178 3:45161465-45161487 TTGACAAGCCTCCTTAACAAAGG - Intergenic
954182801 3:48894855-48894877 TTGCCCAGACTGGAGAGCAATGG + Intronic
954185646 3:48915178-48915200 TTGCCCAGGCTGCAGTACAATGG - Intergenic
954530829 3:51318337-51318359 TTGCCCAGACTGGTGAGCAGTGG - Intronic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
955243215 3:57199577-57199599 TTGCCAAGACTGGAGTGCAATGG - Intronic
955813064 3:62811650-62811672 TTGCTCAGGCAGCTGAACAATGG + Intronic
957472642 3:80679154-80679176 TTGCCCAGACTGCAGTGCAATGG - Intergenic
957826079 3:85446640-85446662 TTGCCCAGACTGGAGTACAAGGG + Intronic
959059137 3:101600380-101600402 TTGCCCAGACTGAAGTACAATGG + Intergenic
960252797 3:115475136-115475158 TCGCCAAGATTGGAGAACAAAGG + Intergenic
960346994 3:116545351-116545373 TTGCCCAGGCTGGAGAACAATGG - Intronic
961662659 3:128477933-128477955 TTGCCAAGACCCCTGAACACTGG - Intergenic
962548579 3:136464381-136464403 TTGCCCAGACTACAGTACAATGG - Intronic
962592274 3:136903462-136903484 TTGCCCAGACTGGAGTACAATGG + Intronic
962619450 3:137162740-137162762 TAGCCAAGACTGGTGTACATAGG - Intergenic
962748396 3:138414575-138414597 ATGCAAAGAATGATGAACAAAGG + Intergenic
963289956 3:143477467-143477489 ATGCCAAGACTGCTGCTCCATGG + Intronic
963319285 3:143795687-143795709 TTGCCCAGGCTGCAGTACAATGG - Intronic
965077402 3:163996194-163996216 TTGCCTAGACTGGAGTACAATGG - Intergenic
965667380 3:171109942-171109964 TTGCCAAGGCTGGAGTACAATGG + Intronic
966078252 3:175965233-175965255 TTGGCAAGGCTGCAGAAGAAAGG - Intergenic
966102111 3:176282924-176282946 TTGCCCAGACTGGAGATCAATGG + Intergenic
966177493 3:177154434-177154456 TTGCCCAGACTGGAGTACAATGG + Intronic
966258853 3:177951087-177951109 TTGCAAAGACTGCTGTAACAAGG - Intergenic
966999640 3:185321641-185321663 TTGCCAAGACTGCAGTGCAGTGG + Intronic
967669633 3:192217874-192217896 TTGCCAAGACTGGAGTGCAATGG + Intronic
968639455 4:1704965-1704987 TTGCCAAGACTGCAGTGCAATGG + Intronic
971083358 4:23241531-23241553 TTGCCCAGACTGAAGTACAATGG + Intergenic
971842765 4:31875213-31875235 TTGCCAAGACTGGAGTGCAATGG - Intergenic
972525017 4:39901305-39901327 TTGCCCAGGCTGCAGTACAATGG + Intronic
972527237 4:39926476-39926498 TTGCCAAGACTGGAGTGCAATGG - Intronic
972786196 4:42328859-42328881 TTGCCAAGACTGGAGTGCAATGG + Intergenic
972997778 4:44903819-44903841 TTGGCAAGACTGCAGAGAAAAGG + Intergenic
973966927 4:56172500-56172522 TTGCCCAGGCTGCTGTGCAATGG + Intronic
973997489 4:56473723-56473745 TTGCCTAGACTGGAGAGCAATGG - Intronic
974160947 4:58138333-58138355 TTGCTAAGAATGCTGTGCAAAGG - Intergenic
974288974 4:59906543-59906565 TTGCCAAGGCTGGAGTACAATGG + Intergenic
975136873 4:70883703-70883725 TTGCCCAGACTGGAGTACAATGG - Intergenic
975540233 4:75502030-75502052 TTGCCCAGGCTGTTGTACAATGG - Intronic
975553748 4:75639490-75639512 TTGCCCAGACTGGAGTACAATGG + Intergenic
976212889 4:82689602-82689624 TTGCCATGACAGCTGCAAAATGG - Intronic
976279632 4:83314216-83314238 TTGCCCAGGCTGCTGTGCAATGG - Intronic
977248058 4:94657744-94657766 TTGCCCAGACTGCAGTGCAATGG + Intronic
978026371 4:103880062-103880084 TTGCCAAGACTGTAGTGCAATGG + Intergenic
978774548 4:112492546-112492568 TTGGCAAGACTGCAGAGAAAAGG + Intergenic
979059115 4:116032763-116032785 TTACCAATATTACTGAACAAAGG + Intergenic
979535122 4:121810640-121810662 TTGCCCAGACTGGAGAACAATGG - Intronic
980045830 4:127987310-127987332 TTGCCAAGACTGGAGTACAGTGG - Intronic
981217075 4:142182705-142182727 ATGCCAAGACAGCTGAGAAAGGG - Intronic
981424039 4:144583199-144583221 ATGCTATGACTGCTGAAAAAAGG - Intergenic
981658424 4:147138427-147138449 CTCCCAGGACTGCTGACCAAAGG - Intergenic
982158441 4:152543073-152543095 TTGCCCAGGCTGCAGTACAATGG - Intergenic
984888322 4:184470648-184470670 TTGCCCAGACTGGTGTACAGTGG - Intronic
985093560 4:186389462-186389484 TTGGCAAGGCTGCAGAAAAAAGG + Intergenic
985504256 5:270072-270094 GTGCCCAGAGTGCTGAATAATGG + Intergenic
985938884 5:3118392-3118414 TTCCCAACACTGCCAAACAACGG + Intergenic
986894472 5:12348547-12348569 TTGCCCAGGCTGCAGAGCAATGG + Intergenic
988924346 5:35974219-35974241 TTTCAGAGACTGCTGAACATTGG + Intronic
989237552 5:39166394-39166416 TTGCCCAGACTGGAGTACAACGG - Intronic
989250963 5:39314407-39314429 TTGCCCAGGCTGCAGTACAATGG - Intronic
989265474 5:39468616-39468638 TTAGCAAGATTGCTGAAAAAAGG + Intergenic
989301070 5:39894292-39894314 TTGCCCAGACTACAGTACAATGG - Intergenic
989575800 5:42987119-42987141 TTGCCCAGACTGGTGTGCAATGG + Intergenic
991067363 5:62438710-62438732 TTGCCCAGACTGGAGTACAATGG - Intronic
991493028 5:67201805-67201827 TTGCCAAGGCTGGAGTACAATGG + Intergenic
991681304 5:69142562-69142584 TTGCCCAGACTGGAGTACAATGG + Intergenic
992416201 5:76554087-76554109 GTGCCAAGACAGTTCAACAAAGG + Intronic
992556437 5:77907941-77907963 TTGCCCAGACTGGAGTACAATGG + Intergenic
993091129 5:83427815-83427837 TTGCCCAGACTGGAGTACAATGG + Intergenic
993341979 5:86735904-86735926 TTGCCTAGACTGGAGTACAATGG + Intergenic
993793272 5:92233643-92233665 TTGCCCAGACTGGAGTACAATGG - Intergenic
994161712 5:96564107-96564129 TTGCCTCTACTTCTGAACAATGG + Intronic
995639782 5:114242222-114242244 TTGTAAAGAGTGCAGAACAAAGG + Intergenic
997236867 5:132277470-132277492 TTGCCAAGACTCGTGACCACTGG + Intronic
997322303 5:132988569-132988591 TTGCCCAGACTGGAGTACAATGG + Intergenic
997371509 5:133364176-133364198 TTTCCAACACTGCTCAGCAAGGG + Intronic
997731546 5:136183456-136183478 TTGCCCAGGCTGCAGTACAATGG - Intronic
999354336 5:150910443-150910465 TTAACAAAACTGCAGAACAATGG + Intergenic
999662602 5:153881387-153881409 TTGCCAAGAATGTTGTAAAAGGG - Intergenic
999684940 5:154094081-154094103 TTGCCAATACAGGTGAAGAATGG - Intronic
999780592 5:154847001-154847023 TTGCCGAGACTGAAGTACAATGG + Intronic
999872288 5:155765238-155765260 TTGCCCAGACTGCAGTACACTGG - Intergenic
999891709 5:155985166-155985188 ATGCCCAGACTTCTGACCAATGG - Intronic
1001699485 5:173696488-173696510 TTGCCAACTCTGCTGCAAAAGGG + Intergenic
1004696197 6:18035391-18035413 TTGCCCAGCCTGGAGAACAATGG - Intergenic
1004920930 6:20375047-20375069 TTGCCAAGACCACTGGACAGTGG + Intergenic
1004947778 6:20634935-20634957 TTGCCCAGACTGGAGTACAATGG - Intronic
1004955731 6:20725742-20725764 TTGCCCAGGCTGCAGCACAATGG - Intronic
1007484005 6:42168164-42168186 TTGCCCAGACTGGAGCACAATGG + Intronic
1007863744 6:44944243-44944265 TTACCATGACTACTGAAAAAAGG + Intronic
1008276941 6:49552969-49552991 TTGCCCAGACTGCAGTGCAACGG + Intronic
1008722368 6:54372029-54372051 TTGCCCAGACTGGAGTACAATGG + Intronic
1008803694 6:55402014-55402036 TTGCCCAGGCTGCAGTACAATGG + Exonic
1009480654 6:64154398-64154420 TTGCCCAGACTGGAGTACAATGG - Intronic
1009694171 6:67076825-67076847 TTGGCTAGAGTGTTGAACAAAGG + Intergenic
1009796185 6:68471451-68471473 TTGCCCAGGCTGCAGCACAATGG + Intergenic
1011296091 6:85827544-85827566 TTGCCATCACTGCTGCCCAAGGG + Intergenic
1011675012 6:89724320-89724342 TTGCCAAGGCTGGAGTACAATGG + Intronic
1013224463 6:108110247-108110269 TTGCCCAGGCTGCAGGACAATGG - Intronic
1013248827 6:108314189-108314211 TTGCCCAGACTGCAGTACAATGG - Intronic
1013717922 6:112985592-112985614 TTGCCTTGACTGCTGAAAAGAGG + Intergenic
1015373849 6:132487922-132487944 TTGCAAAGTCAGCAGAACAAAGG - Intronic
1016519509 6:144930689-144930711 TTGCCCAGGCTGCTGTACAGTGG - Intergenic
1018136899 6:160787812-160787834 TTGCCCAGACTGAAGAGCAATGG + Intergenic
1018355790 6:163014490-163014512 TTGGCAAGACTGCAGAAAAAAGG - Intronic
1018532251 6:164779839-164779861 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1018601523 6:165548839-165548861 TTTTCAAAACTGGTGAACAAAGG - Intronic
1019585790 7:1802584-1802606 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1020159040 7:5754193-5754215 TTGCCCAGACTGCAGTACAATGG + Intronic
1020235466 7:6351967-6351989 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1020566413 7:9801807-9801829 TTGGCAAGAATGTGGAACAAAGG + Intergenic
1021370536 7:19839553-19839575 TTGACAAGACTGCAGAGAAAAGG - Intergenic
1024478725 7:49841904-49841926 TTGCCCAGACTGCAGTGCAATGG + Intronic
1025085096 7:56017171-56017193 TTACCCAGAATACTGAACAATGG + Intronic
1026156706 7:67832625-67832647 TTGCCCAGGCTGGAGAACAATGG + Intergenic
1026578331 7:71593108-71593130 TTGCCTAGACTGCAGTGCAAGGG - Intronic
1027117437 7:75492476-75492498 TTGCCCAGACTGGAGCACAATGG + Intergenic
1027337902 7:77173587-77173609 TTGCCCAGACTGGAGCACAATGG - Intronic
1028828770 7:95304370-95304392 TTGCCCAGACTGGAGTACAATGG + Intronic
1029450661 7:100640528-100640550 TTCCCAGGACCGCTGAACAGGGG + Intronic
1029723322 7:102384832-102384854 TTGCCCAGGCTGGTGTACAATGG - Intronic
1030435696 7:109516976-109516998 TTGTCAGGACTGCTTACCAAAGG + Intergenic
1031025870 7:116679405-116679427 TTGCAAAGAGTGCTGAAAATAGG + Intronic
1032040992 7:128561164-128561186 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1032221887 7:130000731-130000753 TTGCCCAGACTGGAGCACAATGG + Intergenic
1032680945 7:134182799-134182821 TTGCCCAGACTGGAGTACAATGG + Intronic
1033718518 7:144029661-144029683 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1034609566 7:152353531-152353553 TTACCCAGACTGGTGAACAGTGG + Intronic
1034923038 7:155099316-155099338 TTGCCCAGGCTGGTGTACAATGG - Intergenic
1035175874 7:157050563-157050585 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1035222448 7:157414201-157414223 TTACCAAGACCCCAGAACAAAGG - Intronic
1036146625 8:6260263-6260285 TTACCAAGACTGTTGTACGATGG + Intergenic
1036220484 8:6917431-6917453 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1036220705 8:6919804-6919826 TTGCCAAGGCTGCAGTACAGTGG - Intergenic
1038313839 8:26466142-26466164 TTGCCAAGACCGCAGAGGAAGGG + Intronic
1039694008 8:39891327-39891349 TTGCCCAGGCTGGAGAACAATGG - Intergenic
1040361116 8:46665341-46665363 TTGCCAAGACTGCAGTGCAATGG - Intergenic
1041073423 8:54147190-54147212 TTGCCCAGACTGGAGTACAATGG - Intronic
1041309352 8:56498681-56498703 TTGCCAAGGCTGGAGTACAATGG - Intergenic
1044074609 8:87804118-87804140 TTCCCAACACTGGTGTACAAGGG - Intergenic
1044241060 8:89889021-89889043 TTGCCCAGGCTGCTGTACAATGG - Intergenic
1044416349 8:91944460-91944482 TTGCCAAGGCTGGAGTACAATGG - Intergenic
1044682428 8:94795557-94795579 TTGCCCAGACTGCAGTGCAATGG + Intergenic
1044769509 8:95616108-95616130 TTGGCAAAAATGCTGAGCAATGG - Intergenic
1044937375 8:97306177-97306199 ATGCCAGGACTTCTGAACCACGG - Intergenic
1046233695 8:111392810-111392832 TTGCCTAGACAGCTGTTCAAAGG + Intergenic
1046469884 8:114656856-114656878 TTGCCAAGACGGAGGAACAGTGG + Intergenic
1046899012 8:119503482-119503504 TTGCCCAGACTGCTGTGCAGTGG - Intergenic
1047426815 8:124754212-124754234 TTGCCCAGACTGGAGAGCAATGG + Intergenic
1048215658 8:132492210-132492232 TATCCAGGACTGCTGAACACAGG + Intergenic
1048654027 8:136515435-136515457 TTGCCCAGACTGGAGTACAATGG + Intergenic
1048717998 8:137289570-137289592 TTGCCCAGACTGCAGCATAATGG + Intergenic
1049947010 9:606514-606536 TTGCCCAGACTGGAGTACAATGG - Intronic
1050035395 9:1430726-1430748 TTGCCCAGACTGGAGTACAATGG + Intergenic
1050407667 9:5327200-5327222 TTGCTAAGACTGTTGGAAAAGGG - Intergenic
1050468196 9:5955046-5955068 TTGCCCAGGCTGGAGAACAATGG - Intronic
1050655289 9:7821702-7821724 TTGCCAAGGCTGGAGCACAATGG + Intronic
1051157341 9:14164760-14164782 TTGCCAAATTTGCTGAACACTGG + Intronic
1051702911 9:19843470-19843492 TTGCCCAGGCTGCAGCACAATGG - Intergenic
1051753593 9:20370548-20370570 TTGCCTAGGCTGCAGTACAATGG + Intronic
1052065456 9:24013290-24013312 TTGCCAAGAGTGGGGAAAAAGGG - Intergenic
1053155825 9:35778260-35778282 TTGCCCAGGCTGTAGAACAATGG - Intergenic
1053338570 9:37301558-37301580 TTGCCAAGACTGGAGTACAGTGG - Intronic
1053439316 9:38102995-38103017 TTGCCCAGACTGGAGCACAATGG - Intergenic
1054977770 9:71168445-71168467 TTGCCAAGAATGGTGAACAGAGG - Intronic
1055295611 9:74830089-74830111 TTGCCAAGGCTGAAGTACAATGG - Intronic
1055595784 9:77863132-77863154 TTGCCCAGGCTGGAGAACAATGG - Intronic
1055946695 9:81698078-81698100 TTGCCCAGACTGCAGTGCAATGG + Intergenic
1056181599 9:84089103-84089125 TTGCCAAGGCTGGAGTACAATGG + Intergenic
1056905797 9:90646651-90646673 GTGCCAAGACTGCTGGGAAATGG - Intergenic
1057260982 9:93583866-93583888 TTGCCCAGGCTGCAGTACAATGG + Intronic
1058292857 9:103264296-103264318 TTGGCAAGAATGCAGAAAAATGG - Intergenic
1058714761 9:107713777-107713799 TTGCCCAGACTGGAGAGCAATGG + Intergenic
1058916742 9:109574392-109574414 ATGCCCATACTGCTGAACTAAGG + Intergenic
1059869472 9:118555625-118555647 TTGCCCAGCCTGCTGAACAGTGG - Intergenic
1060455216 9:123786172-123786194 TTGCCTAGACTGGAGTACAATGG - Intronic
1060760852 9:126247064-126247086 TTGCCAAGGCTGGAGTACAATGG - Intergenic
1060916395 9:127394012-127394034 TTGCCCAGACTGGAGAACAGTGG - Intergenic
1061361099 9:130142830-130142852 ATGACAAGACTCCTGCACAAAGG - Intergenic
1061532671 9:131227313-131227335 TTGCCAACACTGCTGCCCAGTGG - Intronic
1203426896 Un_GL000195v1:49474-49496 TTGCCCAGACTGGAGTACAATGG + Intergenic
1185585424 X:1239161-1239183 TTGCCCAGGCTGCAGTACAACGG - Intergenic
1186664444 X:11703726-11703748 TTGCCCAGACTGGAGTACAATGG + Intergenic
1187343260 X:18440511-18440533 TTGCCCAGACTGTAGCACAATGG + Intronic
1187406089 X:19005591-19005613 TTGCCCAGACTGGAGTACAATGG + Intronic
1187455293 X:19436112-19436134 TTGCCCAGACTGGAGGACAATGG - Intronic
1188144143 X:26588325-26588347 TTGCCCAGACTGGAGTACAATGG - Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1189612635 X:42753448-42753470 TAGCCAAGGTTGCTGAACACAGG - Intergenic
1189768290 X:44394708-44394730 TTGCCCAGGCTGGAGAACAATGG + Intergenic
1189816466 X:44829302-44829324 TTGCCCAGGCTGCAGTACAATGG - Intergenic
1189971871 X:46426110-46426132 TTGCCCAGACTGGAGTACAATGG + Intergenic
1192419108 X:71013174-71013196 TTGCCAAGACTGGAGTACAGTGG + Intergenic
1192744927 X:73929502-73929524 TTGCCCAGGCTGCAGTACAATGG + Intergenic
1192931451 X:75810630-75810652 TTGCTAAGACTGTTGGAAAAGGG + Intergenic
1193124977 X:77861137-77861159 TTGCCCAGACTGGAGTACAATGG - Intronic
1193558846 X:82992198-82992220 TTAGCAAGGTTGCTGAACAAAGG - Intergenic
1193576376 X:83202624-83202646 TTGCCCAGGCTGCAGCACAATGG + Intergenic
1196205579 X:112935629-112935651 TTGCCCAGACTGGAGTACAATGG - Intergenic
1196259354 X:113559820-113559842 TTGCCCAGGCTGGTGCACAATGG - Intergenic
1196511160 X:116514223-116514245 TTGCCAAGGCTGGAGTACAATGG + Intergenic
1197981299 X:132219687-132219709 TTGCCACGATTGCTCAACACTGG - Intergenic
1198467147 X:136913310-136913332 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1198616667 X:138465254-138465276 TTGCCAAGACTGGAGTGCAATGG + Intergenic
1199218297 X:145286567-145286589 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1199799542 X:151235934-151235956 TTGTAAAGTCTGCTGACCAAAGG - Intergenic
1201885083 Y:18873277-18873299 TTGCCCAGACTGCAGTGCAATGG - Intergenic
1201992599 Y:20043564-20043586 TTGCAAAGACTGTGGGACAAGGG + Intergenic