ID: 955093603

View in Genome Browser
Species Human (GRCh38)
Location 3:55775407-55775429
Sequence CTGTGGTTCGAGCTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 9, 3: 71, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955093596_955093603 27 Left 955093596 3:55775357-55775379 CCTTGTCTCTACTAAAACTACAA 0: 945
1: 67188
2: 163643
3: 186387
4: 117378
Right 955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG 0: 1
1: 0
2: 9
3: 71
4: 354
955093599_955093603 -3 Left 955093599 3:55775387-55775409 CCTGGCGCGGTTGTGCATGCCTG 0: 1
1: 73
2: 3916
3: 27004
4: 101558
Right 955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG 0: 1
1: 0
2: 9
3: 71
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955093603 Original CRISPR CTGTGGTTCGAGCTCTCAGG AGG Intronic
900660883 1:3782836-3782858 CTGTGGTCCCAGCACTCAGGAGG + Intronic
900776579 1:4590270-4590292 CTGTAGTTCCAGCTATCGGGAGG - Intergenic
901071099 1:6518963-6518985 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
901085642 1:6610566-6610588 CTGTAATCCCAGCTCTCAGGAGG + Intronic
901163174 1:7195894-7195916 CTGTAGTCCCAGCTCTTAGGAGG + Intronic
901195108 1:7436075-7436097 CTGTGGCTCGAGCTGCCATGAGG - Intronic
901929666 1:12588967-12588989 CTGTGGTTTGGGGTCTCTGGCGG - Intronic
901960320 1:12821334-12821356 CTGTCGTTCCAGCTACCAGGGGG + Intergenic
902031169 1:13423558-13423580 CTGTTGTTCCAGCTACCAGGTGG - Intergenic
902063539 1:13665335-13665357 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
902118975 1:14145320-14145342 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
902140283 1:14348005-14348027 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
903089309 1:20896312-20896334 CTGTAGTCCCAGCTATCAGGTGG + Intronic
903595701 1:24492582-24492604 CTGTGGTCCCAGCTCTTAGGAGG - Intergenic
903855327 1:26334300-26334322 CTATGGTCCCAGGTCTCAGGAGG + Intronic
905055134 1:35087111-35087133 CTGTAGTTCCAGCTCTTGGGAGG - Intronic
907083806 1:51649996-51650018 CTATAGTCCCAGCTCTCAGGAGG - Intronic
907177713 1:52540391-52540413 CTGTAGTCCGACTTCTCAGGAGG + Intronic
907186145 1:52610715-52610737 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
908243519 1:62208599-62208621 ATGTGGTCCCAGCTATCAGGAGG - Intronic
908530933 1:65033273-65033295 CTGTCATTCTAGCTCCCAGGAGG - Intergenic
908828140 1:68153150-68153172 CTGTGGTTCTAGCTACCGGGAGG + Intronic
909404144 1:75267670-75267692 CTGTAGTCCCAGCTATCAGGAGG - Intronic
909959748 1:81825239-81825261 CTGTGGTCCCCACTCTCAGGAGG + Intronic
910278306 1:85471230-85471252 CTATGGTTCCAGCTCTCAGCTGG + Intronic
910675877 1:89816093-89816115 CTGTGGTCCTAGCTCTTGGGAGG + Intronic
911665308 1:100544525-100544547 CTGTGGTGGGAGCTCTAAGGAGG - Intergenic
912920282 1:113860104-113860126 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
914352423 1:146852079-146852101 CTGTGCAGCGAGCTCTCAGCAGG - Intergenic
914795927 1:150920312-150920334 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
915084122 1:153373346-153373368 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
916709458 1:167390666-167390688 CTGTAGTCCAAGCTATCAGGAGG + Intronic
916758800 1:167798438-167798460 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
920217683 1:204373028-204373050 CTGTAGTCCTAGCACTCAGGGGG - Intronic
920576353 1:207063621-207063643 CTGTGGTAAGAGCTATGAGGAGG + Intronic
920864542 1:209740947-209740969 CTGTGGTCCCATCTCTCTGGAGG - Intergenic
922339253 1:224642350-224642372 CTGTAGTCCCAGCTTTCAGGAGG - Intronic
922766970 1:228161108-228161130 CTGTGGTCCCAGTACTCAGGAGG + Intergenic
922810034 1:228410215-228410237 CTGTGGTCCCAGGACTCAGGAGG - Intronic
923120923 1:230990676-230990698 CTGTGGTTCCAGCTACCTGGGGG - Intronic
923131834 1:231081907-231081929 CTGTAGTCCTAGCTCTCAGGAGG - Intergenic
924012261 1:239677976-239677998 CTGTGGATCGCGCCCTCAGCGGG + Intronic
1063689370 10:8271801-8271823 CTGTAGTTCCAGCTATCAGGAGG + Intergenic
1064275168 10:13898923-13898945 CTGTAATTCCAGCTCTCTGGAGG + Intronic
1064623041 10:17234235-17234257 CTGTGGTTCCAGCTCTTAGGGGG - Intronic
1064823743 10:19371138-19371160 CTGTCGTCCCAGCTCTCAGGAGG + Intronic
1065755207 10:28924697-28924719 CCCTGGCTCCAGCTCTCAGGAGG + Intergenic
1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG + Intergenic
1067117628 10:43447362-43447384 CTGTAATCCCAGCTCTCAGGAGG - Intronic
1068994203 10:63184047-63184069 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1069320216 10:67160557-67160579 CTGTGGTCCCAGCTCTAGGGAGG - Intronic
1069923689 10:71833334-71833356 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1070094202 10:73320787-73320809 CTGTAGTTCCAGCTATCAGGAGG - Intronic
1070204183 10:74239588-74239610 CTCTGGTACTAGCTATCAGGAGG + Intronic
1071170065 10:82853866-82853888 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
1071329862 10:84548606-84548628 CTGTGGTTCTGTCTCCCAGGGGG - Intergenic
1072108281 10:92293658-92293680 CTGTAGTTCCAACTCTCGGGAGG + Intronic
1072700266 10:97635676-97635698 CTGTGGTGCCAGCACTCGGGAGG + Intronic
1072781909 10:98257261-98257283 ATGGGGTTCACGCTCTCAGGGGG - Intronic
1072844530 10:98815158-98815180 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1073290763 10:102412143-102412165 CTCTGGACCAAGCTCTCAGGTGG - Exonic
1073536227 10:104279193-104279215 CTGTGGTTCCGGTTCTCAGTAGG - Intronic
1073849960 10:107603382-107603404 CTGTGGTCCCAGCACTCAAGAGG + Intergenic
1074070434 10:110062457-110062479 CTGTGGTCCCAGCTATTAGGTGG + Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1076443732 10:130497863-130497885 CTGTGGTTCGTGCTCTCTGGAGG + Intergenic
1077494224 11:2878367-2878389 CTGTGGTCCCAGCTCCCTGGGGG - Intergenic
1078123801 11:8538063-8538085 CTGTAGTCCAAGCTTTCAGGAGG + Intronic
1080536049 11:33222792-33222814 CTGTAGTCCCAGCTCTCGGGGGG + Intergenic
1083014600 11:59440183-59440205 CTGTGGTCCCAGCTACCAGGAGG - Intergenic
1084169213 11:67392404-67392426 CTGTCCTGCGAGCTCCCAGGGGG + Intronic
1084415727 11:69032013-69032035 CTGTGGATAGAGCTCTAAGCAGG + Intergenic
1084746673 11:71174729-71174751 CTGTGGTTCCAGCTATTGGGAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086416323 11:86592087-86592109 ATGTGGTCCCAGTTCTCAGGTGG - Intronic
1087246313 11:95841969-95841991 CTGTAGTCCTAGCTTTCAGGAGG + Intronic
1087278414 11:96183518-96183540 CTGTGGTCCCAGTTATCAGGAGG - Intronic
1089984521 11:122800728-122800750 TTGTGGTCCCAGCACTCAGGAGG - Intronic
1090784362 11:130036224-130036246 CTGTAGTCCCAGCTATCAGGGGG + Intergenic
1090962505 11:131569697-131569719 CTGTAGTCCCAGCTCTCAGGTGG - Intronic
1093505588 12:19862113-19862135 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1094552657 12:31467515-31467537 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1095448562 12:42305690-42305712 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1095581830 12:43808686-43808708 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1095939441 12:47716521-47716543 CTGTGTTTGGGGCTCTCAGTGGG - Intronic
1096108523 12:49014004-49014026 CTGTAATTCCAGCTCTCAGGAGG - Intronic
1097175621 12:57141264-57141286 CTGGGGTTTCAGATCTCAGGAGG - Intronic
1097737212 12:63195237-63195259 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1097858453 12:64492842-64492864 CTGAAGTCCCAGCTCTCAGGAGG - Intronic
1097926095 12:65128655-65128677 CTGTAGTTCTAGCTCTTGGGAGG + Intergenic
1099031500 12:77530948-77530970 CTGTAGTCCCAGATCTCAGGAGG + Intergenic
1099272726 12:80532342-80532364 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
1099400377 12:82196055-82196077 CTCTTGTTCTAGTTCTCAGGGGG - Intergenic
1099739409 12:86612616-86612638 CTGTAGTACCAGCTCTCAGGAGG + Intronic
1100752144 12:97710115-97710137 CTGTGGTCCGAGCTACCTGGGGG + Intergenic
1101147703 12:101856773-101856795 CTGTAGTCCCAGCTTTCAGGAGG - Intergenic
1101347673 12:103901486-103901508 CTGAGGTTCCAGCTACCAGGAGG + Intergenic
1101423694 12:104570047-104570069 CTGGGGTTTGATCTCTCTGGTGG + Intronic
1103418802 12:120763351-120763373 CTGTGGATCGAGCTCACAGGGGG - Exonic
1103746157 12:123125718-123125740 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1103958720 12:124594164-124594186 CTGTGGTCTCAGCTCTCAGGAGG - Intergenic
1104037709 12:125109371-125109393 CTGTAATTCCAGCACTCAGGAGG - Intronic
1105502565 13:20985614-20985636 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1105757269 13:23478684-23478706 CTGTAGTTCCAGCTCTTGGGAGG - Intergenic
1106192008 13:27461883-27461905 CTGTAGTTCCAGCTATCGGGAGG - Intergenic
1108644209 13:52410058-52410080 CTGTAGTTCCAGCCATCAGGAGG + Intergenic
1110562217 13:76921536-76921558 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1112656945 13:101461571-101461593 CTGTAGTGCCAGCTATCAGGAGG + Intronic
1112843265 13:103606293-103606315 CTGTGGTTTGAGGTCTCTGGCGG - Intergenic
1113626529 13:111852111-111852133 CTGTGATTCCAGCTCTATGGAGG + Intergenic
1115988367 14:39126299-39126321 CTGTGGTCCCAGCTACCAGGAGG - Intronic
1116642197 14:47478495-47478517 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1116921909 14:50587530-50587552 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1117721192 14:58630414-58630436 CAGTGGATCCAGCTCTCAAGAGG + Intergenic
1118278792 14:64410347-64410369 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1119265583 14:73261781-73261803 CTGTGGTCAGGGCTCGCAGGAGG + Intronic
1119296165 14:73534902-73534924 CTGTAGTTCCAGCTGTTAGGGGG - Intronic
1119317906 14:73710930-73710952 CTGTGGTCCCAGCACTAAGGTGG - Intergenic
1119454388 14:74742235-74742257 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1119805844 14:77481975-77481997 CTGTGGTTCCAGCTATTCGGAGG + Intronic
1120798581 14:88664153-88664175 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1121424580 14:93840487-93840509 CTGTGCTTGGAACTCTCAGGGGG - Intergenic
1121653046 14:95574106-95574128 CTGTGGTTCCATCCCCCAGGGGG + Intergenic
1122626485 14:103087846-103087868 CTGGGGTCACAGCTCTCAGGAGG - Intergenic
1123726560 15:23109000-23109022 CTGTGGTCCCAGCTATCGGGAGG - Intergenic
1125730348 15:41889538-41889560 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1126013037 15:44321347-44321369 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1126669222 15:51101136-51101158 CTGTGGTTCCAGCTTTCATGAGG + Intronic
1127456233 15:59158470-59158492 CTTGGATTCCAGCTCTCAGGTGG + Intronic
1127747963 15:62000241-62000263 CTATGATCCCAGCTCTCAGGAGG + Intronic
1128083711 15:64871954-64871976 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1129196798 15:73973278-73973300 TTGTGGTTCGGGCTCCCATGGGG + Intergenic
1129409646 15:75342414-75342436 CTGTGGTTCCAGCACTTGGGAGG + Intronic
1130339169 15:82984692-82984714 CTGTAGTCCCAGCTCTCCGGAGG + Intronic
1130605224 15:85309931-85309953 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
1131109227 15:89754288-89754310 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1134263160 16:12670171-12670193 CTGTGGTCCTAGATCTCAGGAGG + Intronic
1134766439 16:16762939-16762961 CTGTAGCTCCAGCACTCAGGGGG - Intergenic
1135520675 16:23175261-23175283 CTGGGGTTCAGGGTCTCAGGAGG - Intergenic
1136181803 16:28558064-28558086 CTGTAGTCCCAGCTTTCAGGAGG - Intronic
1137243237 16:46677656-46677678 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1138368155 16:56500501-56500523 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1138397844 16:56719718-56719740 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1138954079 16:61949864-61949886 CTGTAGTCCCAACTCTCAGGGGG + Intronic
1138982129 16:62282082-62282104 CTGTAGTTCCAGCTGTCGGGAGG + Intergenic
1139135844 16:64204041-64204063 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1139639495 16:68280854-68280876 CTGTTGTCCCAGCACTCAGGAGG - Intronic
1139679133 16:68546632-68546654 CTGTAGTCCCAGTTCTCAGGAGG - Intronic
1140228707 16:73099748-73099770 CTGTGTGTCCTGCTCTCAGGAGG + Intergenic
1140324590 16:73989423-73989445 CTGTAGTCCCAGCACTCAGGTGG + Intergenic
1140455840 16:75105108-75105130 CTCTGGTTTGAGGGCTCAGGTGG + Intronic
1141348875 16:83274472-83274494 CTGTGGTAAGTGCTTTCAGGAGG - Intronic
1141573362 16:84948146-84948168 CTGTGGTCCCAGCTCCCCGGGGG + Intergenic
1141990892 16:87608913-87608935 CTGTGGTCCCACCACTCAGGAGG + Intronic
1143182499 17:4992402-4992424 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1143853171 17:9828076-9828098 CTGTGGTACCAGGTCTCATGAGG + Intronic
1144045138 17:11448408-11448430 CTGTAGTCCAAGCTATCAGGAGG + Intronic
1144133632 17:12271625-12271647 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
1144689959 17:17254686-17254708 CTGTAGTCCCAGCTCTCGGGAGG + Intronic
1144859483 17:18291834-18291856 CTGTAGTCCCAACTCTCAGGAGG - Intronic
1148362993 17:47029054-47029076 CTGTGATCCTAGCTATCAGGAGG + Intronic
1148591250 17:48818006-48818028 CTGTGGTCCCAGCTATCGGGAGG + Intergenic
1148932003 17:51134639-51134661 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG + Intergenic
1149749770 17:59134671-59134693 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1150038877 17:61836231-61836253 CTGTGGTCCCAGCTACCAGGAGG - Intronic
1150363895 17:64563862-64563884 CTGTAGTTCTAGCTACCAGGAGG - Intronic
1151444797 17:74156224-74156246 CTGAGGCTCCAGCTCCCAGGAGG + Intergenic
1151832637 17:76563904-76563926 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1152017156 17:77758167-77758189 CTGGGGTTCCAACGCTCAGGTGG + Intergenic
1152674350 17:81630407-81630429 CTGTGGTTCCAGCTCTCGGGAGG - Intronic
1152855607 17:82663436-82663458 CTGCGGTTCCAGCTCTGGGGCGG - Intronic
1152886089 17:82850864-82850886 AGGTGTTTTGAGCTCTCAGGAGG - Intronic
1153078994 18:1198222-1198244 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
1153753644 18:8259069-8259091 CTGTAGTTCCAGCTTTCAGGAGG - Intronic
1154016529 18:10623546-10623568 CTGTGGTTCCAGCTACCAGGGGG - Intergenic
1154188982 18:12212117-12212139 CTGTGGTTCCAGCTACCAGGGGG + Intergenic
1155305562 18:24474806-24474828 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1158074026 18:53508013-53508035 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1160173216 18:76571645-76571667 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1161438248 19:4276874-4276896 CTGTGGTCCTAGCTACCAGGAGG + Intergenic
1161757954 19:6148521-6148543 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1162080205 19:8213419-8213441 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1162499848 19:11046551-11046573 CTGTGCTTCCAGCACTCAGGAGG - Intronic
1162875764 19:13619796-13619818 CTGTGGTCCCAGCTCTCGGGAGG - Intronic
1163385035 19:16994638-16994660 CTGTGGTCCCAGCTATCAGGAGG - Intronic
1164797882 19:31049610-31049632 CTCTGATTCCAGTTCTCAGGGGG + Intergenic
1164847224 19:31442947-31442969 CTGTGGTCCCAGGACTCAGGAGG + Intergenic
1165207652 19:34204594-34204616 CTGTAGTCCTAGCACTCAGGAGG + Intronic
1165644644 19:37424995-37425017 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1165861118 19:38909992-38910014 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1166116271 19:40656889-40656911 GTGTGGCTGGAGCTCTGAGGAGG - Intergenic
1166129236 19:40736166-40736188 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1166347016 19:42172831-42172853 CTGTGGATGGACATCTCAGGGGG + Intronic
1166654606 19:44601456-44601478 CTGTAGTTCCAGCTACCAGGAGG - Intergenic
1166671229 19:44710633-44710655 CTGTGGCTCTAGCTCTAGGGTGG - Exonic
1167138203 19:47631175-47631197 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1167335685 19:48884320-48884342 CTATGGTCCCAGCTCTCAAGAGG + Intronic
1167835866 19:52069193-52069215 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
925168749 2:1737659-1737681 CTGTAGTTCCAGCTATCGGGAGG - Intronic
925410745 2:3638551-3638573 CTGGGGTTTGAGCTGTGAGGGGG + Intronic
925641357 2:5988692-5988714 CTGGGCCTCTAGCTCTCAGGTGG - Intergenic
925741757 2:7010861-7010883 CTGTGCTCCGTGCTCTCATGGGG - Intronic
926235206 2:11036670-11036692 TTGTTGTTCCAGTTCTCAGGGGG + Intergenic
926898938 2:17728311-17728333 CTGTAGTACCAGCTCTCAGGAGG + Intronic
927947040 2:27141407-27141429 CTGTGGTCCCAGCTATCTGGTGG - Intergenic
928312188 2:30220272-30220294 CTGTGGCTAGAGGTCTCAGTGGG - Intergenic
928812980 2:35252223-35252245 CTGTGCTTCAAGATTTCAGGAGG - Intergenic
929249560 2:39737988-39738010 CTGTGTATCCAGCTCTCTGGTGG - Intronic
929496063 2:42445266-42445288 CTGTGATACGAGTTCTGAGGTGG + Intronic
930252900 2:49055249-49055271 CTGTTGTTGAAGCTCTCAGCTGG - Intronic
930725830 2:54680536-54680558 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
930980419 2:57519104-57519126 CTGTAGTTCTAGCTATTAGGAGG + Intergenic
931214580 2:60229056-60229078 GTTTGGTTAGAGCTCTGAGGTGG - Intergenic
932337832 2:70941037-70941059 CTGTGGTCCCAGCTCTCAGGAGG - Exonic
933360345 2:81274736-81274758 CTGTAGTCCTAGCTCTCAGGAGG - Intergenic
934458570 2:94196655-94196677 CTGTGATTCGAACTGTCAGTGGG - Intergenic
934570236 2:95366101-95366123 CTGTAGTCCTACCTCTCAGGAGG - Intronic
934730942 2:96657195-96657217 CTGTGGTTCCAGCTATCCTGGGG - Intergenic
936106941 2:109632695-109632717 CTGTAGTCCGAGTACTCAGGAGG + Intergenic
936458392 2:112692967-112692989 CTCTGGTTGCAGCTCCCAGGTGG - Intergenic
937103772 2:119291640-119291662 GTGTGGTTGGAGCTGACAGGTGG + Intergenic
937108006 2:119337175-119337197 CTGTAGTGCCAGCACTCAGGAGG - Intronic
939757398 2:146130969-146130991 CTGTGGTTGGAAGTTTCAGGGGG + Intergenic
940042581 2:149376094-149376116 CTGTTGTTTCAGCTCTGAGGCGG - Intronic
942439966 2:176022718-176022740 CTGTGGTTCCAGCTAACAAGAGG + Intergenic
943644104 2:190389598-190389620 CTGCGGTTGCAGCACTCAGGAGG + Intergenic
943712416 2:191111737-191111759 CTGTAGTGCCAGCTCTCAAGAGG + Intronic
943985688 2:194615111-194615133 CTGTAGTCCCAGCTGTCAGGAGG - Intergenic
944702833 2:202261017-202261039 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
946014061 2:216589740-216589762 CTGTGGTTCTGGCTCTCACGGGG - Intergenic
947724795 2:232390305-232390327 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
948497395 2:238360756-238360778 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1169792484 20:9426498-9426520 CTGTAGTTCTAGCTATCGGGAGG - Intronic
1169871979 20:10257587-10257609 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1170822969 20:19769778-19769800 CTGTGTTTCAAGACCTCAGGAGG + Intergenic
1170828594 20:19819655-19819677 CTGTGGTCCCAGCTACCAGGAGG - Intergenic
1171568946 20:26227292-26227314 CTGTGGTCATAGCTATCAGGAGG + Intergenic
1172551649 20:35805158-35805180 CTGTGGTCCCAGCACTCAGGAGG - Intronic
1172552561 20:35813088-35813110 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1172729144 20:37071015-37071037 CTGTAGTCCCAGCTGTCAGGAGG - Intronic
1174323535 20:49761190-49761212 CTGTGCTCCCAGCTATCAGGAGG - Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1175050079 20:56147114-56147136 CACTGATTCTAGCTCTCAGGAGG - Intergenic
1175394462 20:58649469-58649491 CTGGGGTCAGAGCTCGCAGGGGG + Intergenic
1175474306 20:59259391-59259413 CTGTGGTTCGTGCCCTCCTGTGG - Intergenic
1176269397 20:64227841-64227863 CTGCGGTTCCAGCACTAAGGTGG + Intronic
1178300287 21:31447312-31447334 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1178336802 21:31750609-31750631 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
1178868061 21:36346685-36346707 CTGTGGTCCCAGCTACCAGGAGG + Intronic
1180281982 22:10708358-10708380 CTGTGGTCATAGCTATCAGGAGG - Intergenic
1180858314 22:19062197-19062219 ATGTGGCTGGGGCTCTCAGGAGG + Intronic
1181227177 22:21399507-21399529 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1181357633 22:22309779-22309801 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1182498524 22:30728271-30728293 CTGTGGTCCCAGCACTCGGGAGG + Intronic
1183505987 22:38209185-38209207 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1183523043 22:38307427-38307449 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1183569764 22:38644022-38644044 CTGTAGTTCCAGCTATCGGGAGG + Intronic
1183983986 22:41559336-41559358 CTCTGGGTAGAGTTCTCAGGTGG + Intergenic
1184839730 22:47045746-47045768 CTGTGGTTGGAGATCACAGCAGG - Intronic
1184958663 22:47912429-47912451 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
1185337518 22:50277367-50277389 CTGTGGTGAGAGGTCTCAGGAGG + Intronic
949814593 3:8044629-8044651 GTGTTGTTCCAGTTCTCAGGGGG - Intergenic
950237354 3:11334833-11334855 CTGTAATCCCAGCTCTCAGGAGG + Intronic
950368770 3:12509320-12509342 CTGTAGTTCCAGCTACCAGGAGG - Intronic
950769423 3:15299613-15299635 CTGTGGTCCTAGCCCTTAGGAGG - Intronic
951067350 3:18282542-18282564 CCCTGGTTCCAGCTCTCTGGAGG - Intronic
952182933 3:30937858-30937880 GTCTTGTTCGAGTTCTCAGGAGG + Intergenic
953602208 3:44378256-44378278 CTGTAATCCCAGCTCTCAGGAGG + Intronic
953743229 3:45554618-45554640 CTGTAGTTGGAGGCCTCAGGTGG - Intergenic
954055440 3:48019752-48019774 CTGTGGTCCCAGCTCTTGGGAGG + Intronic
955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG + Intronic
955188674 3:56739520-56739542 CTGTGGTCCCAGCTATCAGGAGG - Intronic
955301828 3:57787596-57787618 CTGTAATCCCAGCTCTCAGGAGG - Intronic
955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG + Intergenic
958707036 3:97668789-97668811 CTGTAGTCCCAGCTCTCGGGAGG + Intronic
959225690 3:103581307-103581329 CTCAGGTTATAGCTCTCAGGTGG - Intergenic
959302065 3:104615454-104615476 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
959564006 3:107815803-107815825 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
960379566 3:116943283-116943305 GTGTTGTTCCAGTTCTCAGGGGG - Intronic
960636298 3:119788234-119788256 CTGTAGTCCCAGCTCTCTGGGGG - Intronic
961184122 3:124899730-124899752 CTGTGGTCCCACCACTCAGGAGG + Intronic
961241163 3:125412838-125412860 CTGTAGACCCAGCTCTCAGGAGG - Intergenic
962016758 3:131448762-131448784 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
962251283 3:133837682-133837704 ATGTGGTTGGAACTCACAGGAGG - Intronic
964013810 3:151922393-151922415 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
966552109 3:181216674-181216696 CTGTGGTTCCAGCTCCCATCAGG - Intergenic
966576997 3:181513122-181513144 CTGTAATTTCAGCTCTCAGGAGG - Intergenic
966998908 3:185313065-185313087 CTGTAGTTTCAGCTCTCAGGAGG + Intronic
968095030 3:195923292-195923314 CTGTAGTCCTAGCTCTCAGGAGG + Intergenic
969577266 4:8043716-8043738 CTGTTGTTCAAGCCCCCAGGAGG + Intronic
971252203 4:24982802-24982824 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
971265255 4:25091258-25091280 CTATGGTCCCAGCTATCAGGAGG + Intergenic
971398449 4:26252462-26252484 CTGTGGTCACAGCTCTCAGAAGG + Intronic
971740961 4:30520598-30520620 CTGTAGTTCCAGCCCTGAGGTGG + Intergenic
971762869 4:30790799-30790821 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
972571899 4:40318662-40318684 CTGTGGTCCCAGCTCTCTGGAGG + Intergenic
972578501 4:40374191-40374213 CTGATTTTTGAGCTCTCAGGAGG + Intergenic
972665656 4:41162731-41162753 CTGCGGTCCCAGCACTCAGGAGG + Intronic
973620072 4:52717371-52717393 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
977713856 4:100158744-100158766 CTGTAGTCCTAGCTCTCAGGAGG + Intergenic
977975773 4:103264920-103264942 GTGTTGTTCCAGTTCTCAGGGGG + Intergenic
978426513 4:108588364-108588386 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
979265778 4:118701308-118701330 CTGTGGTCCCAGCTATTAGGAGG - Intronic
979786504 4:124721752-124721774 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
979794602 4:124831139-124831161 GTGTTGTTCCAGCTCTCAGAGGG + Intergenic
979984798 4:127300437-127300459 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
983671000 4:170237666-170237688 CTGTGGTTTGGGTTGTCAGGGGG + Intergenic
984717183 4:182936688-182936710 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
985552826 5:541961-541983 CTCTGTTTGAAGCTCTCAGGTGG + Intergenic
986023801 5:3830957-3830979 CTGTGGTCCTAGCTATGAGGAGG + Intergenic
986546507 5:8903844-8903866 CTGTGCTTCCAGCTCACTGGAGG - Intergenic
989025037 5:37058041-37058063 CTGTAATTCCAGCCCTCAGGAGG - Intronic
989122821 5:38021214-38021236 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
989607655 5:43260295-43260317 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
990172173 5:53064662-53064684 CTGTAGTCCTAGCTCTCAGGAGG - Intronic
990737402 5:58879174-58879196 CTGTGGCTTCTGCTCTCAGGAGG + Intergenic
990771348 5:59249963-59249985 CTGTAGTACCAGCTCTCAAGAGG - Intronic
991221128 5:64219634-64219656 TTGTAGTCCCAGCTCTCAGGAGG - Intronic
991916565 5:71611278-71611300 CTATGGTTCCAGCTTTCAGGAGG + Intronic
993503350 5:88685231-88685253 CCGTGGTTCGAGCTCGCGCGTGG - Intergenic
993610422 5:90046704-90046726 CTGTAATTCCAGCTCTCAGGAGG + Intergenic
993927336 5:93884879-93884901 CTGTGGTTAGAGCACATAGGTGG - Intronic
994014376 5:94947736-94947758 CTGTGGTCCCAGCTCTAGGGAGG - Intronic
997708422 5:135981220-135981242 CTTTAGTTCCAGCACTCAGGAGG - Intergenic
997798016 5:136830557-136830579 GTGTTGTTCCAGTTCTCAGGAGG + Intergenic
999171543 5:149599335-149599357 CTGTGGTTGGAGACCTGAGGAGG - Intronic
1001356828 5:171034942-171034964 CTATGGTCCCAGTTCTCAGGAGG - Intronic
1001491330 5:172157711-172157733 CTGTAGTTCCAGTTCTCGGGAGG - Intronic
1002782427 6:377645-377667 CTTTGGTTGAAGCTCTCAGCAGG - Intergenic
1003042010 6:2696935-2696957 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1004454279 6:15777279-15777301 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
1005516780 6:26562418-26562440 CTGTGTTTTCAGCTCTCAGCTGG - Intergenic
1005568664 6:27123353-27123375 CTATAGTCCCAGCTCTCAGGAGG + Intergenic
1006504691 6:34481166-34481188 CTGTAGTCCCAGCTCTCGGGGGG - Intronic
1006762212 6:36473020-36473042 CTGTAATTCCAGCTATCAGGAGG - Intronic
1007263191 6:40578006-40578028 CTGTGCTGGGAGCACTCAGGGGG - Intronic
1007619981 6:43206034-43206056 CTTTGGTTCGAGCTGGCTGGAGG + Exonic
1007660677 6:43483940-43483962 CTGTGGTCCTAACCCTCAGGAGG + Intronic
1007787495 6:44289590-44289612 CTGGAGTTTGAGCTCTCAGTGGG - Intronic
1010173742 6:73001999-73002021 CTATAGTCCCAGCTCTCAGGAGG + Intronic
1010619281 6:78054538-78054560 CTGTGGTAGAAGCTCTCTGGTGG + Intergenic
1010654763 6:78499216-78499238 GTGTTGTTCCAGTTCTCAGGGGG + Intergenic
1010825153 6:80464247-80464269 CTGTGGTCCCAGTACTCAGGAGG - Intergenic
1011670987 6:89682823-89682845 CTGTGGTCCCAGCACTCAGGAGG + Intronic
1013238548 6:108221666-108221688 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1015690282 6:135914612-135914634 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1019385830 7:755607-755629 CTGTGGTTCCAGCTCCCGGGAGG + Intronic
1019401795 7:858895-858917 CTGTGATTCCAGCACTCTGGAGG + Intronic
1020049290 7:5071481-5071503 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1020064673 7:5178173-5178195 CTGTGGTCCCAGCTCTCGGGAGG + Intergenic
1023641804 7:42266470-42266492 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
1023947080 7:44811749-44811771 CTGTAGTTCCAGCTACCAGGAGG - Intronic
1024326546 7:48113832-48113854 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1024934990 7:54702718-54702740 CTGTGGTCCCAACTCTCTGGAGG - Intergenic
1025091358 7:56066740-56066762 CTGTAATCCCAGCTCTCAGGAGG - Intronic
1025833918 7:65078244-65078266 TTGTGGTCCCAGCTCTTAGGAGG + Intergenic
1025998324 7:66542522-66542544 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1026177691 7:68012448-68012470 CTGTGGTCCCAGCTCTAGGGAGG + Intergenic
1026991276 7:74587320-74587342 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1027151109 7:75734322-75734344 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1028556040 7:92125871-92125893 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1028789423 7:94835917-94835939 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030001664 7:105070688-105070710 CTGTGGTCCCAGCTCTTTGGGGG + Intronic
1030715037 7:112799667-112799689 CTCTGGTTCAAGCTCTCAAATGG - Intergenic
1031413191 7:121464994-121465016 CTGAGGTAAGAGCTCTCAGATGG - Intergenic
1031615315 7:123872669-123872691 CTGTGGCTCAAGCTTTCAGGTGG + Intronic
1031850293 7:126854998-126855020 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
1032419044 7:131762939-131762961 CTGTGGCTCCAGCCATCAGGAGG - Intergenic
1033473852 7:141672090-141672112 CTGTGCTGGGACCTCTCAGGAGG - Intronic
1034172792 7:149075783-149075805 CTGTAGTCCCAGCTGTCAGGAGG - Intronic
1034661847 7:152777826-152777848 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1034741833 7:153481532-153481554 CTGTAGTCCCAGCTCTCCGGAGG + Intergenic
1035423251 7:158747223-158747245 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1038099661 8:24359198-24359220 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
1038561533 8:28585315-28585337 CTGTGGTTCCAGTTATCAGGAGG - Intergenic
1039578379 8:38643955-38643977 CTGTAGTCCCAGCTCTCAAGAGG - Intergenic
1042139783 8:65666282-65666304 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1042198584 8:66256788-66256810 CTGTAGTCCCAGCTGTCAGGAGG + Intergenic
1042281043 8:67056312-67056334 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1042482606 8:69321240-69321262 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
1044273286 8:90271861-90271883 CTGTGGTTCCAGCTCCCACCAGG - Intergenic
1044572058 8:93731036-93731058 CTGTAGTCCCAGCTCTCAGGAGG + Exonic
1044971956 8:97628494-97628516 CTGTGGTCCCAGCTATCAGGAGG + Intergenic
1045076793 8:98578226-98578248 CCTTGGTTCTTGCTCTCAGGGGG - Intronic
1045463903 8:102451559-102451581 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1046926435 8:119794272-119794294 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1047486407 8:125334875-125334897 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1047614304 8:126550583-126550605 CTGTGATCCCAGCACTCAGGAGG - Intergenic
1048170704 8:132103494-132103516 CTGTGGTCCTAGCTATCGGGAGG + Intronic
1048620533 8:136128197-136128219 CTCTGGTTCAATCTCTCATGAGG + Intergenic
1048685108 8:136896158-136896180 CTGTAGTCCCAACTCTCAGGAGG - Intergenic
1048981041 8:139703509-139703531 CTGTGGGTCCAGCTCGCGGGTGG + Intergenic
1050104719 9:2153408-2153430 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1050133313 9:2435746-2435768 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1051304302 9:15692249-15692271 CTGTAGTCTCAGCTCTCAGGAGG + Intronic
1051792890 9:20828047-20828069 CTGTTGTCCCAGCACTCAGGAGG + Intronic
1053055729 9:34992107-34992129 CTGTAGCTAGAGCTCTCTGGGGG - Intronic
1053373047 9:37578692-37578714 CTGTAATTCCAGCTATCAGGAGG + Intronic
1053689070 9:40572471-40572493 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054274964 9:63058595-63058617 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1054300314 9:63373403-63373425 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054399862 9:64706334-64706356 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054433450 9:65190595-65190617 CTGTGATTCGAACTGTCAGTGGG - Intergenic
1054496935 9:65831074-65831096 CTGTGATTCGAACTGTCAGTGGG + Intergenic
1054768513 9:69063070-69063092 CTGTAGTCCCAGCTCTCTGGAGG + Intronic
1057845204 9:98517484-98517506 CTGCGTTTCGGGCTCTCAGCAGG - Intronic
1058288070 9:103205099-103205121 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
1058849129 9:108993456-108993478 CTGTGGTTTGAATTCTCAGGAGG - Intronic
1059404770 9:114092844-114092866 ACGTGGTTCCTGCTCTCAGGAGG - Intronic
1060120787 9:120987514-120987536 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1060158376 9:121336482-121336504 CTGAGGTCAGAGCGCTCAGGGGG + Intergenic
1060724585 9:125998526-125998548 CTGTGGTCCCAGCTATGAGGTGG + Intergenic
1061546168 9:131305749-131305771 CTGTAGTTTCAGCTATCAGGAGG - Intronic
1061797383 9:133094830-133094852 CTGTGGTCCCAGCTCTCAAGAGG - Intergenic
1185536097 X:862745-862767 CTGTAGTCCAAGCTCTCGGGAGG - Intergenic
1188459256 X:30404384-30404406 CTGTGGCTCCAGCTCTCATCTGG - Intergenic
1189297059 X:39926316-39926338 CTGGGGCTCAGGCTCTCAGGGGG + Intergenic
1190034088 X:47004550-47004572 CTGTGGTCCCAGCTCTTGGGAGG - Intronic
1190232871 X:48595791-48595813 CTGTGGTCCCAGCTCCCGGGAGG + Intronic
1191820118 X:65297071-65297093 CTCTTGTTCCAGTTCTCAGGTGG - Intergenic
1192856810 X:75020742-75020764 CTGTGGTCCCAGCTCTCGGCTGG - Intergenic
1193118052 X:77794635-77794657 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1193397968 X:81008175-81008197 GTATTGTTCGAGCTCTCAGGGGG + Intergenic
1193934520 X:87600359-87600381 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1194633870 X:96320234-96320256 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1195855219 X:109324314-109324336 CTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1195962056 X:110396566-110396588 CTGTAATTCCAGCTCTGAGGAGG - Intronic
1196648094 X:118139809-118139831 CTGTAGTCCTAGCTCTCAGAAGG + Intergenic
1196711986 X:118771849-118771871 CTGTAGTTCTAGCTCCCGGGAGG + Intronic
1196899104 X:120365861-120365883 CCGGGGTTCCAGCTCTCAGATGG + Intronic
1198180305 X:134201436-134201458 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1198786751 X:140297149-140297171 CTGTGGCTAGAGCTCTGGGGAGG - Intergenic
1201474411 Y:14364940-14364962 CTGTAATCCCAGCTCTCAGGAGG + Intergenic