ID: 955103344

View in Genome Browser
Species Human (GRCh38)
Location 3:55873180-55873202
Sequence GATGGGAGCCAATGCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955103333_955103344 25 Left 955103333 3:55873132-55873154 CCAAAATAATTCCCCCACAGCTC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217
955103337_955103344 12 Left 955103337 3:55873145-55873167 CCCACAGCTCTCCTGCATGGAAT 0: 1
1: 0
2: 1
3: 10
4: 167
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217
955103338_955103344 11 Left 955103338 3:55873146-55873168 CCACAGCTCTCCTGCATGGAATG 0: 1
1: 0
2: 1
3: 28
4: 380
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217
955103340_955103344 1 Left 955103340 3:55873156-55873178 CCTGCATGGAATGATGGAAGTGT 0: 1
1: 0
2: 2
3: 7
4: 125
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217
955103335_955103344 14 Left 955103335 3:55873143-55873165 CCCCCACAGCTCTCCTGCATGGA 0: 1
1: 0
2: 0
3: 33
4: 614
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217
955103336_955103344 13 Left 955103336 3:55873144-55873166 CCCCACAGCTCTCCTGCATGGAA 0: 1
1: 0
2: 3
3: 22
4: 240
Right 955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG 0: 1
1: 1
2: 0
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955103344 Original CRISPR GATGGGAGCCAATGCAGAGT GGG Intronic
900005154 1:40424-40446 GCTGGGAGCCAATGCAGCCCTGG - Intergenic
901138193 1:7011117-7011139 GAAGGAAGCCACTGCAGACTTGG + Intronic
903301679 1:22383654-22383676 GATGGGAGCCAGGGCATAGATGG - Intergenic
905388737 1:37622823-37622845 GATGAGAGCCAAACCACAGTGGG + Intronic
906147499 1:43568719-43568741 TATGGGAGCCCATGTACAGTGGG + Intronic
907415328 1:54310408-54310430 GCTGGGGGAAAATGCAGAGTTGG + Intronic
909263674 1:73527843-73527865 GATGCCAGCCAATTCAGAATTGG - Intergenic
909482645 1:76142148-76142170 GATGGGAGGGAATGCGGAGAGGG + Intronic
909530442 1:76675866-76675888 GATGGGAGCCATTATTGAGTAGG - Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
912820770 1:112865933-112865955 GATTAGAGCCAAAGAAGAGTTGG + Intergenic
913254230 1:116939446-116939468 GAAAGGAGCCAATGCAGAGCTGG - Intronic
913270758 1:117090834-117090856 CAAGGAAGCCAATGAAGAGTAGG - Intronic
915486989 1:156228358-156228380 CTTGAGAGCCAATGCAGAATTGG - Intronic
916854130 1:168732568-168732590 GATGGAAGGCATTGCAGAATGGG - Intergenic
916890418 1:169107332-169107354 GATGGGATCTAATGCAGACGAGG + Intronic
916910181 1:169337568-169337590 AGTGGGAGCCCATGCAGAGGAGG + Intronic
917869800 1:179230802-179230824 GACGGGAGCCACTGCAAAGAAGG + Intergenic
918853282 1:189718788-189718810 AATGGGAGCCCAGGCAGAGGAGG + Intergenic
920084566 1:203405905-203405927 GATGGGAGGCTGTGCAGAGAGGG - Intergenic
920866141 1:209755647-209755669 GAAAGGAGCAAATCCAGAGTTGG + Intergenic
921063580 1:211607128-211607150 GAAGGAAGCCCATGCAGAGATGG - Intergenic
922461686 1:225818305-225818327 GATGGGAGCCAAAGCAGACATGG + Intronic
1063318805 10:5033008-5033030 AGTGGGAGCCCAGGCAGAGTAGG + Intronic
1063942192 10:11142207-11142229 GATGGGAGCAAATTCTGATTTGG + Intronic
1065238780 10:23684558-23684580 CCTGGGAACCAGTGCAGAGTGGG - Intergenic
1067299427 10:44995339-44995361 GGTGGAGGCCAAGGCAGAGTTGG + Exonic
1071713292 10:88070782-88070804 GATGGGAGGCATTCCAGAGAAGG - Intergenic
1072308680 10:94133278-94133300 GATGAAAGCCAATGGAGTGTGGG + Intronic
1074292479 10:112148848-112148870 GATGGGAGGCAAGGAAGAGTTGG + Intergenic
1074316935 10:112369658-112369680 AGTGGGAGCCAAGGCAGAGGAGG - Intergenic
1074882448 10:117669492-117669514 GAGGGGAGCCCAGGCAGACTGGG + Intergenic
1077268085 11:1661884-1661906 CGTGGGTGCTAATGCAGAGTGGG - Intergenic
1077272834 11:1689850-1689872 CGTGGGTGCTAATGCAGAGTGGG + Intergenic
1077985381 11:7346386-7346408 GATGGGACCCAGAACAGAGTTGG + Intronic
1079938101 11:26642862-26642884 GATGGGAGACAAAACAGAGGAGG - Intronic
1082933989 11:58637900-58637922 GGTGGGGGCCAAGGCAGAATAGG - Intergenic
1083141868 11:60728840-60728862 GATGGGAGGCTAGGCAGAGTTGG - Intergenic
1083226082 11:61285686-61285708 GAGGAGAGCCAGGGCAGAGTGGG - Intronic
1084238060 11:67800866-67800888 CATGGGAGACAATGCAGGGCGGG - Intergenic
1084858184 11:72001980-72002002 GAAGGGACCCAAAGCAGAGAAGG - Exonic
1087234213 11:95700393-95700415 GAGGGGAACAAATGCAGTGTGGG - Intergenic
1087268212 11:96083906-96083928 GATGGGAGCTAATCCATATTAGG + Intronic
1087815463 11:102653509-102653531 GCTGTGAGCCAAAGCTGAGTAGG + Intergenic
1088784588 11:113169600-113169622 GATGGGAGACTTTTCAGAGTTGG + Intronic
1090190494 11:124763184-124763206 GATGGGAGGCACTGAAGATTTGG - Intergenic
1090658181 11:128861598-128861620 CCTGGGAGCCACTGCAGAGCGGG + Intronic
1090688788 11:129155921-129155943 AAGGCGAGCCAAAGCAGAGTGGG + Intronic
1090734112 11:129596405-129596427 GACAGGTGCCAATGGAGAGTGGG + Intergenic
1091379138 12:44599-44621 GCTGGGAGCCAATGCAGGCCTGG - Intergenic
1092408730 12:8238496-8238518 CATGGGAGACAGTGCAGGGTGGG - Intergenic
1092934501 12:13347895-13347917 GATGGAAGCAGATGGAGAGTGGG + Intergenic
1096258523 12:50077067-50077089 GAGGGGAGCAAATGGAGAATGGG + Intronic
1101363025 12:104045437-104045459 GCTGGGAGCCACTGCAGGGCAGG + Intronic
1101636973 12:106551885-106551907 AATGTGAGCCAAAGCAGGGTAGG - Intronic
1102387311 12:112520380-112520402 AATGGGAGCCCAGGCAGAGGAGG + Intergenic
1102675769 12:114657488-114657510 GATGGAAGGCGATGCAGAGGGGG + Intergenic
1104249272 12:127075505-127075527 GATGGGAGAGGGTGCAGAGTTGG + Intergenic
1106454579 13:29916049-29916071 CATGGCAGCCAAAGCAGACTTGG + Intergenic
1108358613 13:49650064-49650086 GAAGGAAGCCAAGGCTGAGTGGG + Intergenic
1108495546 13:51020909-51020931 GATGGGAGCCACTTCAATGTAGG - Intergenic
1117069403 14:52043132-52043154 GCTGGGTCCCATTGCAGAGTTGG + Intronic
1117526204 14:56607865-56607887 CATGAGAGCTATTGCAGAGTTGG - Intronic
1117876867 14:60261551-60261573 GATTGGAACCAGTACAGAGTAGG + Intronic
1118306256 14:64658048-64658070 AGTGGGAGCCAAGGCAGAGGAGG - Intergenic
1119436998 14:74604142-74604164 GGTGAGAGGCAATGTAGAGTTGG - Intronic
1119651874 14:76389597-76389619 TCTGGGAGGCAATGCAGTGTTGG + Intronic
1119941969 14:78650520-78650542 GATGGGAGCCAAGGGAGGGTAGG + Intronic
1122292554 14:100687477-100687499 GATGGGAGCCCATGCAGAGTGGG + Intergenic
1122648917 14:103214420-103214442 GAGAGGAGACAGTGCAGAGTGGG + Intergenic
1123107678 14:105850282-105850304 GATGGCAGCCAAGCCAAAGTTGG - Intergenic
1126329239 15:47514036-47514058 CTTGTGAACCAATGCAGAGTGGG - Intronic
1126670575 15:51111748-51111770 GACAGGAGGCAATGCAGAGCAGG + Intergenic
1129661474 15:77555265-77555287 GTTGGGAGCTAGAGCAGAGTAGG + Intergenic
1130252370 15:82307885-82307907 TATGGGAGCCAAGGCTGCGTAGG + Intergenic
1131108171 15:89748425-89748447 GAGGGGCGGTAATGCAGAGTGGG - Intergenic
1131403454 15:92144896-92144918 GATGTGATCAAATGCAGAGATGG + Intronic
1132448359 15:101950520-101950542 GCTGGGAGCCAATGCAGCCCTGG + Intergenic
1132873893 16:2127467-2127489 GACGGGAGCCAGTGCAGCCTGGG - Intronic
1134552979 16:15146641-15146663 GACGGGAGCCAGTGCAGCCTGGG - Intergenic
1135016766 16:18930125-18930147 GATGGGAACAAATGCAGGGAAGG - Intergenic
1135322401 16:21505978-21506000 GATGGGAACAAATGCAGGGAAGG - Intergenic
1135474018 16:22757490-22757512 GATGGGAGCCAGTGAAGAGGAGG + Intergenic
1136333878 16:29599108-29599130 GATGGGAACAAATGCAGGGAAGG - Intergenic
1136560801 16:31038210-31038232 GATGGGAGGCACAGCAGAGAGGG - Intronic
1137859484 16:51831687-51831709 GACGGGATCTAATGCAGAATAGG - Intergenic
1138081307 16:54093788-54093810 GATGGGGGCAAAGGCAGGGTGGG - Intronic
1138376164 16:56565320-56565342 GCTGGGAGCCAACAGAGAGTGGG - Intronic
1138550461 16:57744923-57744945 CCAGGGAGCCAAGGCAGAGTGGG - Intronic
1138693677 16:58791276-58791298 AATGGGAGCCCAGGCAGAGGAGG + Intergenic
1138866345 16:60825141-60825163 GATGATATCCAATGCACAGTTGG + Intergenic
1138924849 16:61579125-61579147 GATGGCAGCCAATGAAGTTTGGG + Intergenic
1139440757 16:66965486-66965508 GATGGTGGCCAAGGCAGTGTGGG + Intronic
1141301295 16:82818203-82818225 AATGGCAGCAAATGCAGAGCAGG - Intronic
1144294717 17:13862963-13862985 GATTGGAGGCCATGAAGAGTTGG - Intergenic
1144739295 17:17572307-17572329 GCTGGGAGCCATTGCAGAGGTGG - Intronic
1144942107 17:18948869-18948891 GAGGGGAGCCCAGGCAGGGTCGG + Intergenic
1146465130 17:33080183-33080205 GAAGGGGGCCAAGGCAGAGTGGG + Intronic
1147567782 17:41548157-41548179 GCTGTGAGCCAGTGCAGAGATGG - Intergenic
1148777251 17:50102542-50102564 GAGGAGACCCACTGCAGAGTGGG - Intronic
1151852794 17:76700999-76701021 GCTGGGAGCAGATGCCGAGTAGG + Intronic
1154001867 18:10488482-10488504 GCTGGAATCCAATGCAGAGTTGG + Exonic
1156692684 18:39727477-39727499 GATGGAAGTAAATACAGAGTTGG - Intergenic
1156716920 18:40023100-40023122 GAAGGGAGACAGTGCAGAGAGGG + Intergenic
1157926909 18:51776762-51776784 GATGGGTGGCACTGCAGAGCTGG + Intergenic
1158372237 18:56821480-56821502 AATGTGAGGCAGTGCAGAGTAGG - Intronic
1159554913 18:69935543-69935565 TGTGGGTGCCAATGCAGCGTGGG - Intronic
1160379891 18:78446266-78446288 GATGTGAGCCACAGCCGAGTCGG + Intergenic
1160636908 19:82033-82055 GCTGGGAGCCAATGCAGCCCTGG - Intergenic
1161113573 19:2483913-2483935 GATGTGAGCAAAAGGAGAGTAGG - Intergenic
1162303594 19:9858049-9858071 GATGGGAGCCAGTGGGTAGTAGG - Intronic
925099047 2:1230085-1230107 GGTGGGAGCCCAGGCAGAGGAGG + Intronic
925337976 2:3112447-3112469 GGTGGGTGTCCATGCAGAGTGGG - Intergenic
925445075 2:3920473-3920495 CATGGGAGCCAATCCAGTGGTGG + Intergenic
925493659 2:4423016-4423038 GATGGGAGCCACTGAAGGGCAGG + Intergenic
928842604 2:35628572-35628594 GATGGAAGGCATTGTAGAGTCGG - Intergenic
929968414 2:46552622-46552644 TTTGGGAGCCCATGCAGAGGTGG - Intronic
930990729 2:57650812-57650834 CAGGGGAGCCAAGGCAGAGCTGG - Intergenic
933279199 2:80313985-80314007 GAAGGGAGGCAAGGAAGAGTAGG + Intronic
933694987 2:85210954-85210976 GACGGGAGGCAGTGCAGAGTGGG - Intronic
933893048 2:86788900-86788922 CATGGGACCCAAAGCAGGGTGGG + Intronic
936564569 2:113573008-113573030 GCTGGGAGCCAATGCAGGCCTGG + Intergenic
937820443 2:126304289-126304311 GATGGGAACAAAAGCAGAGAAGG - Intergenic
938400951 2:130991317-130991339 AATGGGAGCCCACGCAGAGGAGG - Intronic
938560123 2:132464882-132464904 GATGGGAGCCAATTCCCAGGGGG + Intronic
938647111 2:133342956-133342978 GATGGGAGGTAGTGTAGAGTGGG + Intronic
939777429 2:146404182-146404204 AATGGGAGCCCAGGCAGAGGAGG + Intergenic
940388520 2:153103410-153103432 GCTGGGGGCCTATGTAGAGTGGG - Intergenic
942062763 2:172243128-172243150 GATGGGAGCCAAGGCTGCATTGG + Intergenic
942828650 2:180211549-180211571 CATGGGAAACAATGAAGAGTAGG + Intergenic
942867211 2:180691257-180691279 AGTGGGAGCCAAGGCAGAGGAGG - Intergenic
943322119 2:186457376-186457398 GATGGGAGACCAGGCACAGTAGG + Intergenic
943616346 2:190096890-190096912 GATGGGATCCGAGGGAGAGTTGG - Intronic
944054489 2:195509337-195509359 GATGGGATCCATTGCACAGATGG - Intergenic
946423045 2:219575585-219575607 GCTGGGAGGAAAGGCAGAGTTGG + Exonic
1170854351 20:20036988-20037010 GATAGGAGCCTATCCAGAGAAGG - Intronic
1171041838 20:21771325-21771347 GATGAGAGACAATGCAGTGATGG - Intergenic
1172801330 20:37578400-37578422 GATGAGAGCAATTGCAGATTAGG + Intergenic
1173306528 20:41855974-41855996 GCTGGGATCTCATGCAGAGTGGG + Intergenic
1174287022 20:49481072-49481094 GGTGGGAGCCAAGGCAGGGCAGG - Intronic
1174367897 20:50067510-50067532 GATGGGAACCATTGCAGAGGAGG - Intergenic
1176023785 20:62975718-62975740 GATGTGAGCCACTGCAGGTTTGG - Intergenic
1180741123 22:18053847-18053869 AATGGGAGCCCAGGCAGAGGAGG + Intergenic
1180902650 22:19385856-19385878 GATGGGAGGCGATGGGGAGTTGG - Intronic
1182128032 22:27830325-27830347 GATGGGAGCCCCTGCAGGGTGGG + Intergenic
950702825 3:14761824-14761846 GATGGGAGCAGGTGCAGAGTGGG + Intronic
950775351 3:15345244-15345266 GAAGGGAGCCAACACAGAGGAGG - Intergenic
951579434 3:24146479-24146501 GGTGGGAGCCATTGCTGGGTGGG - Intronic
952902409 3:38118994-38119016 GAAGGGAGCAAACGCAAAGTGGG - Intronic
952996999 3:38894303-38894325 GAGGGGAGCAAAATCAGAGTGGG - Intronic
953038206 3:39231656-39231678 CATGCCAGCAAATGCAGAGTGGG - Intergenic
953831535 3:46301655-46301677 GGTGGGACCCAAGGCAGAGCAGG - Intergenic
954432566 3:50478773-50478795 GATGGTACCAAATGCAGAGTTGG - Intronic
955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG + Intronic
955724352 3:61917230-61917252 GATGTGAGCCACTGCAGGGCAGG - Intronic
960107969 3:113818321-113818343 GAAGGGAGCAAAAGCAGGGTTGG + Intergenic
960914847 3:122684751-122684773 AATGGGAGCCAGTGAAGATTGGG - Intronic
961163499 3:124749038-124749060 GCAGGGAGACAATGCAGTGTTGG - Intergenic
961953848 3:130779568-130779590 CTTGGGAGCCAACTCAGAGTTGG + Intergenic
963233460 3:142933108-142933130 GATGCGAGTCAAGGTAGAGTAGG + Intergenic
964936372 3:162093764-162093786 AATGGAAGCCAAAGAAGAGTAGG - Intergenic
967259528 3:187628309-187628331 GATGGGAGGGAAAGCACAGTGGG - Intergenic
968258397 3:197298721-197298743 AGTGGAAGGCAATGCAGAGTTGG - Intronic
969258733 4:6020797-6020819 AAGAGGAGCCAGTGCAGAGTGGG + Intergenic
969814859 4:9679732-9679754 AGTGGGAGCCAAAGCAGAGGAGG - Intergenic
970865028 4:20748312-20748334 GATGGGAAGCAATGGAGAGTGGG - Intronic
971809706 4:31408862-31408884 AATGGCAGTCACTGCAGAGTAGG - Intergenic
973308006 4:48675211-48675233 AATGGGAGCCCAGGCAGAGGAGG - Intronic
975093192 4:70426730-70426752 GATGAGAGCCAGTGCAGTGATGG - Intergenic
976395271 4:84548941-84548963 GATGAGAGCCCACGCGGAGTGGG - Intergenic
976801426 4:88996147-88996169 GTGGGGAGACAATGCAGAGAGGG + Intronic
977074679 4:92438657-92438679 CATGGTAGCCAACGAAGAGTTGG - Intronic
978236231 4:106464193-106464215 GATGTGAGACAATGGAGTGTGGG + Intergenic
981836846 4:149064672-149064694 GATGAGACCCAGTGCAGTGTGGG + Intergenic
983910513 4:173233703-173233725 GATGGGAGCCAAAGCAGTCATGG - Intronic
984521569 4:180808341-180808363 GATGGGATCCAATGTACATTCGG - Intergenic
985611096 5:889787-889809 GGTGGGAGCCAAGGCTGAGTCGG - Intronic
989562930 5:42872002-42872024 GATGGGAGTAGATGCGGAGTGGG - Intronic
989730520 5:44642072-44642094 GAGGGGGGCCAAAGGAGAGTAGG + Intergenic
994938690 5:106290777-106290799 GATGGGAGGCAGAGCAGAGGGGG + Intergenic
999661721 5:153871350-153871372 GATCGGAGCCACTGCAGATGTGG + Intergenic
1001635932 5:173210552-173210574 GATGGAAGCAAATGCTGATTTGG + Intergenic
1002996031 6:2286373-2286395 GGTGCGAGCCGAAGCAGAGTGGG + Intergenic
1004380989 6:15132226-15132248 TATTGGAGCCAAAGCAGATTGGG + Intergenic
1004908453 6:20259442-20259464 AGTGGGAGCCCATGCAGAGGAGG - Intergenic
1007342525 6:41200719-41200741 TAAAGGAGCCAATGCAGAGAGGG + Intronic
1009510861 6:64548152-64548174 AGTGGGAGCCAAGGCAGAGGAGG + Intronic
1009685261 6:66949087-66949109 AATGGGAGCCCAGGCAGAGGAGG - Intergenic
1009727942 6:67558632-67558654 GAGGGCAGCCAAAGCAGGGTGGG - Intergenic
1011379177 6:86724244-86724266 GAGGGGATGGAATGCAGAGTGGG - Intergenic
1014055817 6:117014632-117014654 AATGGGAGCCCAGGCAGAGGAGG - Intergenic
1018635853 6:165858714-165858736 GATGGGAGTCAATGCTGAATTGG - Intronic
1020321088 7:6939352-6939374 CATGGGAGACAATGCAGGATGGG - Intergenic
1020988523 7:15166682-15166704 GATGGGAGTCAAAGCAGTGAAGG + Intergenic
1023129377 7:36987264-36987286 GATGGCAGCACATTCAGAGTTGG - Intronic
1023856653 7:44188319-44188341 GCTGGGGGCCCAGGCAGAGTGGG - Intronic
1024827162 7:53404168-53404190 GATGGTAGCCCATGCAGACTAGG + Intergenic
1026141095 7:67707503-67707525 GATGGGATCCAGGGTAGAGTTGG - Intergenic
1026734744 7:72942434-72942456 GATGGGAGCCACAGCAGAGGTGG - Exonic
1026785078 7:73297346-73297368 GATGGGAGCCACAGCAGAGGTGG - Intergenic
1027109001 7:75422584-75422606 GATGGGAGCCACAGCAGAGGTGG + Exonic
1030770228 7:113465580-113465602 GATGGGCCCCAAAGCAGTGTAGG - Intergenic
1033303698 7:140208995-140209017 GCAGGGAGCCAGTGCAGAGAGGG + Intergenic
1034260244 7:149750984-149751006 GAAGGGAAACATTGCAGAGTGGG - Intergenic
1034621314 7:152459410-152459432 GATGGAGGACAATGCTGAGTAGG - Intergenic
1035264540 7:157684043-157684065 GACGGGAGGAAATGAAGAGTTGG - Intronic
1036380439 8:8233023-8233045 CATGGGAGACAGTGCAGGGTGGG + Intergenic
1036849126 8:12189637-12189659 CATGGGAGACAGTGCAGGGTGGG - Intronic
1036870487 8:12431911-12431933 CATGGGAGACAGTGCAGGGTGGG - Intronic
1038893629 8:31755780-31755802 GATGGGGTAGAATGCAGAGTAGG - Intronic
1042104284 8:65308147-65308169 TATGGGAGCAAATGCACAGAAGG + Intergenic
1042248086 8:66728124-66728146 GATGGGAGTCACTGGACAGTGGG - Intronic
1043352565 8:79377699-79377721 AGTGGGAGCCCATGCAGAGTGGG + Intergenic
1043352569 8:79377716-79377738 AGTGGGAGCCCATGCAGAGGAGG + Intergenic
1043411472 8:80001874-80001896 GATGTCACCGAATGCAGAGTTGG - Intronic
1044075748 8:87820705-87820727 AGTGGGAGCCTATGCAGAGGAGG - Intergenic
1047920431 8:129629353-129629375 GAAGGGAGAGAAAGCAGAGTTGG - Intergenic
1048442140 8:134468007-134468029 GCTGGGAGCCTGTGCAGGGTTGG - Intergenic
1049443074 8:142617995-142618017 GTGGGGGGCCAAGGCAGAGTTGG - Intergenic
1049887849 9:40206-40228 GCTGGGAGCCAATGCAGGCCTGG - Intergenic
1051612901 9:18978859-18978881 AGTGGGAGCCCATGAAGAGTTGG - Intronic
1053392599 9:37746412-37746434 TCTGGGAGCCCATGCAGAGGCGG - Exonic
1054847239 9:69810167-69810189 GATGGGAGCCACTTCAGAATTGG + Intergenic
1055253760 9:74340495-74340517 GAGGAGAGACAATGCAGAGGTGG + Intergenic
1058286492 9:103186785-103186807 AATGGGAGCCCAGGCAGAGGAGG - Intergenic
1059659510 9:116387427-116387449 GAAGTGAGCCACTCCAGAGTAGG - Intronic
1060671015 9:125469570-125469592 CAGGGGAGACAATGCAGAGATGG + Intronic
1060800920 9:126545493-126545515 GATGGGAGTCCAGGCAGGGTGGG - Intergenic
1062189568 9:135240953-135240975 GATGGTAGCCAGGGAAGAGTGGG - Intergenic
1185695109 X:2188222-2188244 AATGAGATCCTATGCAGAGTTGG + Intergenic
1185796726 X:2971908-2971930 GATGGGAGCCCAGTCAGAGATGG - Intergenic
1187705807 X:22008276-22008298 GGTGGGAGCCCATGCAGCTTTGG - Intergenic
1189074743 X:37904343-37904365 ATTGGGAGAGAATGCAGAGTGGG + Intronic
1189152861 X:38725876-38725898 TATGTTGGCCAATGCAGAGTTGG + Intergenic
1189274314 X:39773990-39774012 GATGTCACCAAATGCAGAGTCGG - Intergenic
1189502309 X:41574254-41574276 GAGGGGAACTAAGGCAGAGTAGG - Intronic
1189539410 X:41970827-41970849 GAAGGAAGGCAATACAGAGTGGG - Intergenic
1196832963 X:119790812-119790834 AATGGGAGCCAATACAAAGAAGG + Intronic
1196869240 X:120097063-120097085 GAGGGGAGCCAATAGGGAGTAGG + Intergenic
1197825774 X:130588828-130588850 GATGGGATCCAAAGCAAAGTCGG - Intergenic
1199543612 X:148984443-148984465 GATGAGAGCTAAGTCAGAGTTGG + Intronic
1201468266 Y:14309168-14309190 GGTGGGCGCCAAGGCAGAGGAGG - Intergenic
1201512383 Y:14779524-14779546 GGAGGGAGGAAATGCAGAGTAGG - Intronic