ID: 955103463

View in Genome Browser
Species Human (GRCh38)
Location 3:55874170-55874192
Sequence AGTCAACTGCCTCCAAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955103463_955103466 -9 Left 955103463 3:55874170-55874192 CCATACCTTGGAGGCAGTTGACT 0: 1
1: 0
2: 0
3: 13
4: 106
Right 955103466 3:55874184-55874206 CAGTTGACTTGTACTTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
955103463_955103467 -8 Left 955103463 3:55874170-55874192 CCATACCTTGGAGGCAGTTGACT 0: 1
1: 0
2: 0
3: 13
4: 106
Right 955103467 3:55874185-55874207 AGTTGACTTGTACTTGGCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955103463 Original CRISPR AGTCAACTGCCTCCAAGGTA TGG (reversed) Intronic
900829597 1:4956496-4956518 AGTCATCTGCCTTGAAGGCAAGG + Intergenic
902885554 1:19402294-19402316 AGGCCACTGCCTCCTAGGAAAGG + Intronic
902991988 1:20194415-20194437 AGCCAACAGCCTTCAAGGCAGGG + Exonic
904270005 1:29343749-29343771 AGTTAACTCCCTCCAGGGTTAGG - Intergenic
904856344 1:33500891-33500913 TGTCACCTGCCACCAAGTTAGGG - Intergenic
906163381 1:43667925-43667947 AGTGAACTGCCTCCAAGAGCTGG + Exonic
907802307 1:57781861-57781883 ATTCAAATGTCTTCAAGGTACGG + Intronic
908564449 1:65340202-65340224 AGTCCACTCCCTCCCAGGCAAGG - Intronic
912374712 1:109200884-109200906 AATCATTTACCTCCAAGGTAGGG + Exonic
915004432 1:152623316-152623338 TGTCAGCTGCCTCCCAGGCAGGG - Intergenic
916469605 1:165109796-165109818 AGTCAATTGCCTCCTTGGTATGG - Intergenic
917237503 1:172910104-172910126 AGTTAACTGCATCCAAAGAAGGG + Intergenic
921129131 1:212204639-212204661 ACTCAAATGCCTCCAGGGTTTGG + Intergenic
923413253 1:233730813-233730835 AGTCAACTGCTGACAGGGTAGGG + Intergenic
924034456 1:239922166-239922188 ATACAACTGCCTTCAAGGAAAGG + Intergenic
1064347910 10:14549238-14549260 AGTCAACTGCCTTCAAAGGCAGG + Intronic
1067656309 10:48194586-48194608 AGTCCCCTGCCTCTAAGGGATGG - Intronic
1074344884 10:112675328-112675350 AGTCATCTGCCTCCAGGGGCTGG + Intronic
1075571997 10:123552894-123552916 AGTCAGCAGCCTCCAAGGTTGGG - Intergenic
1078183437 11:9031168-9031190 TGTCAACTGCTTCCAAAGTATGG + Intronic
1081381087 11:42416186-42416208 AGACAACTACCTACAAGGCAAGG - Intergenic
1082997290 11:59264143-59264165 AGTCTACTGCCTGCCAGGCAGGG - Intergenic
1085083572 11:73652302-73652324 AGTCAGCTGCGTCCCAGGCAGGG + Intronic
1085440321 11:76556047-76556069 ATTCAACTTCCACCTAGGTATGG + Intergenic
1085462862 11:76705548-76705570 AGCCAAATGTCTGCAAGGTAGGG + Intergenic
1085849284 11:80100675-80100697 AGTGAGAAGCCTCCAAGGTAAGG - Intergenic
1086255298 11:84868573-84868595 AGTCAACTGCCTCCTAGCCTAGG - Intronic
1086802452 11:91193837-91193859 AGTGAACAGCCTCCATGGGAAGG + Intergenic
1090960184 11:131549462-131549484 TGTCAACTGCCTACAAGATGTGG + Intronic
1091273638 11:134334835-134334857 AGGCAACTGGCTCAAAGGCACGG - Intronic
1091770678 12:3149188-3149210 CCTCACCTGCCTCCAGGGTAGGG + Intronic
1093537116 12:20235840-20235862 AATCAAATGCCTACAAGATAAGG + Intergenic
1095871638 12:47034837-47034859 AGACAAATGCCTCCAAGCCAAGG - Intergenic
1099465969 12:82988473-82988495 AGGCACCTGCCTTCAAGGCAAGG + Intronic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1106107608 13:26747026-26747048 AGTCAACTGCATTAAAGGTGTGG - Intergenic
1106692790 13:32136428-32136450 AGACAACTACCTCTAAGATAGGG + Intronic
1107388010 13:39933439-39933461 AGTCAACTGCCTGCAAGCTCCGG + Intergenic
1108923248 13:55702773-55702795 AGTTAACTGCCTCTCAGTTAGGG - Intergenic
1114701133 14:24679696-24679718 AGTGAACTGGCTGCAAGGTGCGG - Intergenic
1115857873 14:37650515-37650537 AGTAAATAGCCTCCAAGGGAGGG + Intronic
1122724656 14:103742224-103742246 AAGCAGCTGCCTCCAAGCTATGG - Exonic
1125569078 15:40701114-40701136 AGGCAACAGCCTCCACAGTATGG - Exonic
1128125814 15:65192128-65192150 AGTCAACTGTGTCCATGGTGGGG - Intergenic
1129388912 15:75210836-75210858 AGTCACCGGCCCCCAAGGTCAGG + Exonic
1132485328 16:187356-187378 AGCCAACTGTCTCCAAGGAAAGG - Intergenic
1135067514 16:19322914-19322936 AGTCAACAGCCCCAAAGATACGG - Intergenic
1135979453 16:27136035-27136057 AGCCAAGTACCTGCAAGGTAAGG + Intergenic
1138681697 16:58688328-58688350 TCTCAACTGCCTCCAAGTTTGGG + Intergenic
1140978185 16:80080976-80080998 AGTCAGCTGGTTCCAAGGTCTGG + Intergenic
1153367874 18:4278979-4279001 TCACAACTGCCTCCAAGGTCAGG - Intronic
1153392582 18:4578896-4578918 AGTCAAATGCATCCAAGGCTTGG + Intergenic
1155064720 18:22258362-22258384 AGTCACTTGCCTCAAAGCTATGG - Intergenic
1157124112 18:44938648-44938670 ATTCACCTTCCTCCGAGGTAAGG - Intronic
1162687368 19:12399418-12399440 AGTCATGTGTCTCCAAGGAATGG + Intronic
1162691685 19:12439270-12439292 AGTCATGTGTCTCCAAGGAATGG + Intronic
928199021 2:29235212-29235234 AGTCACTTTCCTCCAAGGTCAGG - Intronic
929758077 2:44784713-44784735 AGTCTACTGCCTCTGAGGCATGG + Intergenic
930946869 2:57085176-57085198 AGTCGGCTGCCTCCAAGATACGG + Intergenic
943911345 2:193571967-193571989 TGTTAACTGCCCCCATGGTAGGG + Intergenic
944015840 2:195036537-195036559 CTGCAACTGCCTACAAGGTACGG + Intergenic
944157192 2:196619834-196619856 AGACAACTGGCTACCAGGTATGG - Intergenic
945485121 2:210386170-210386192 ACTCAAGTGCTTCCAGGGTATGG + Intergenic
946691065 2:222308501-222308523 AGGAAACTCCCTCCAAGGCAGGG + Intergenic
947639679 2:231700065-231700087 TCTCAGCTGCCTCCAAGGTAAGG - Intergenic
1168997790 20:2145774-2145796 AGACAGCTGCCCCCAAGGAAAGG - Exonic
1172962295 20:38807302-38807324 TCTCAACTGCCTCTAAGATACGG + Intronic
1173398338 20:42701829-42701851 ACTCAAATACCTCCAAGGTATGG - Intronic
1174392070 20:50223855-50223877 ACTCAACTGCCTACAAGATCGGG - Intergenic
1176681149 21:9819960-9819982 AGTCGACTTCCACCAAGGGAGGG + Intergenic
1181018409 22:20084833-20084855 AAGCAACTGCATCCAAGGCACGG - Intronic
1183226073 22:36550789-36550811 AGCCAACTCCCTCCAAGGCTTGG - Intergenic
1184925782 22:47636260-47636282 AGACAAATGACTCCAAGGTAGGG - Intergenic
950643491 3:14363418-14363440 AATTAACTGGCACCAAGGTAGGG - Intergenic
953681560 3:45042641-45042663 AGCCAGCTGCCTCCTAGGTTAGG + Intergenic
954677041 3:52321831-52321853 AGTCCTCTGGCTCCAGGGTATGG + Intronic
955103463 3:55874170-55874192 AGTCAACTGCCTCCAAGGTATGG - Intronic
955147628 3:56336003-56336025 GTTGAACTGCCTACAAGGTAGGG - Intronic
958115813 3:89216879-89216901 AGTCAACTTCTTCCAGCGTAAGG + Intronic
960940178 3:122928215-122928237 AGTCAGGACCCTCCAAGGTAAGG + Intronic
967416276 3:189222191-189222213 AGTCAAATGCCTGTAAGGGATGG + Intronic
967630934 3:191742375-191742397 AGGCAACACCCTCCAAGGAAAGG - Intergenic
972399949 4:38691480-38691502 AACCAACTGCCTCCAAGGGAGGG + Intronic
975362482 4:73487078-73487100 AGTCAACTGCCTTCAAACAAGGG + Exonic
986630346 5:9766630-9766652 TGTCAACTGAATACAAGGTAAGG + Intergenic
989434051 5:41390855-41390877 AGGCCACTGCCGCCAGGGTAGGG - Intronic
992896603 5:81251268-81251290 AGGCTATTTCCTCCAAGGTAAGG + Exonic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997918430 5:137952856-137952878 AGTCAAGTTCTCCCAAGGTAAGG + Intronic
998374988 5:141684613-141684635 AGTCCACTGACTCCAAGTTAAGG + Intergenic
1008522266 6:52373593-52373615 AGCCAACTGGCTCCCAGGTGAGG - Intronic
1010144193 6:72647223-72647245 AGTCACCTGCCTACACGGCAAGG - Intronic
1013853551 6:114543787-114543809 ACTCTAATGCCTTCAAGGTAAGG - Intergenic
1015213104 6:130720280-130720302 GGTCAGCTGCAGCCAAGGTAGGG - Intergenic
1016153966 6:140780724-140780746 AGCCCACTGCCTTCAAGGGAAGG + Intergenic
1018061071 6:160090133-160090155 ATTTAACTTCCTCCAAGGAAGGG + Intronic
1022795754 7:33730281-33730303 TGTCAACTTCTTCCAAGGTAGGG - Intergenic
1025096726 7:56101566-56101588 AGTCATTTTCTTCCAAGGTATGG - Exonic
1032386874 7:131531195-131531217 AGCCAACAGCCTCCAAGGACAGG - Intronic
1034416801 7:150969575-150969597 AGTCACCTGACTCCCAGGGAAGG + Intronic
1037807808 8:22068111-22068133 CATCAACTGCCTCCAAGACAGGG + Intronic
1040603954 8:48911248-48911270 AATCAACTGTCTCCCAGATAAGG - Intergenic
1044375305 8:91463403-91463425 AGTCAAATACTTCCAAAGTAGGG - Intergenic
1047631038 8:126708778-126708800 AGGCAACTGCAGCCAAGGTGAGG + Intergenic
1047995010 8:130326335-130326357 ATTCACCTGCCTGCAATGTAAGG + Intronic
1050456710 9:5841461-5841483 AATCAACTGCTTAAAAGGTATGG + Intergenic
1050770163 9:9188609-9188631 AGTCAACTGAATCCTAGGTCAGG - Intronic
1052690790 9:31814509-31814531 TTTCAACTGCCTCCAAGAAAAGG - Intergenic
1053780040 9:41598265-41598287 ACCCAACTGCCTTCAAGGTCAGG + Intergenic
1054167997 9:61808508-61808530 ACCCAACTGCCTTCAAGGTCAGG + Intergenic
1054669549 9:67772396-67772418 ACCCAACTGCCTTCAAGGTCAGG - Intergenic
1055191627 9:73531337-73531359 TGTGAACTGCCTTCAGGGTAGGG + Intergenic
1056163421 9:83920767-83920789 AGTCACCTGCCTCCGAGGGAGGG + Intronic
1058980025 9:110160445-110160467 AAGCGACTGCCTCCAAGGTGGGG + Intronic
1059853862 9:118373622-118373644 ATTCAACTGCATTCAAGGAAGGG - Intergenic
1060126804 9:121055355-121055377 AGTCCACTGCCTCCAAGACCAGG - Intergenic
1190301734 X:49060982-49061004 AGTCACCTGCCACCTAGGTTAGG + Intronic
1190407396 X:50101556-50101578 GGAAAACTGCCTCCAAGGCAAGG - Intergenic
1191011262 X:55761899-55761921 AATCAGCTGCCCCCAAGATAAGG + Intergenic
1193700253 X:84751480-84751502 AGAAAACTCCTTCCAAGGTAAGG + Intergenic