ID: 955106446

View in Genome Browser
Species Human (GRCh38)
Location 3:55903133-55903155
Sequence CAAATACCTGTATCATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955106443_955106446 -1 Left 955106443 3:55903111-55903133 CCTATTAAACTCCAAGCTTCACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG 0: 1
1: 0
2: 2
3: 8
4: 131
955106442_955106446 12 Left 955106442 3:55903098-55903120 CCATTTATATTCACCTATTAAAC 0: 1
1: 0
2: 3
3: 25
4: 297
Right 955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG 0: 1
1: 0
2: 2
3: 8
4: 131
955106441_955106446 22 Left 955106441 3:55903088-55903110 CCAGATTGTACCATTTATATTCA 0: 1
1: 0
2: 2
3: 20
4: 274
Right 955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG 0: 1
1: 0
2: 2
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955106446 Original CRISPR CAAATACCTGTATCATGCTT TGG Intronic
900732309 1:4270295-4270317 GAAATAACTGGATCATGCATAGG - Intergenic
904718436 1:32487196-32487218 TAAACACCTGTCTAATGCTTTGG - Exonic
907568347 1:55458594-55458616 CTAATACCAATATCATTCTTTGG - Intergenic
907699881 1:56775510-56775532 CAATTACATGTATCAATCTTTGG + Intronic
909399891 1:75215598-75215620 CATATCCCTGAATCATGCATTGG + Intronic
910031880 1:82736038-82736060 CAAGTACCTTTTTCATGCCTTGG + Intergenic
910204851 1:84739641-84739663 CAAATACCTGTGGCATGTCTGGG - Intergenic
910453679 1:87372768-87372790 CAAATACCTGTGTCAGGGTTGGG - Intergenic
916094795 1:161339644-161339666 AAAACACCTGTATCAGGATTAGG - Intronic
916126173 1:161573418-161573440 CAAAAGCCAGTATCAGGCTTTGG - Intergenic
916136091 1:161655258-161655280 CAAAAGCCAGTATCAGGCTTTGG - Intronic
917043213 1:170829382-170829404 AAAACACCTGTAGCATGGTTGGG - Intergenic
917533094 1:175854678-175854700 CAAATAACTGACTAATGCTTTGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
921011850 1:211149515-211149537 CAAATAGCTGTATCAACCTGGGG + Intergenic
922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG + Intronic
923179892 1:231506630-231506652 GAATTACCTTTATCAAGCTTTGG + Intergenic
924426008 1:243950995-243951017 TAAATAACTATATAATGCTTAGG - Intergenic
1066217493 10:33301822-33301844 CAAACATCTGTGTCATTCTTGGG + Intronic
1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG + Intergenic
1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG + Exonic
1068981412 10:63066397-63066419 CAAATGCCTGAACCATGCCTTGG - Intergenic
1072361854 10:94667053-94667075 CAAATACTTGTATCGTTCTCTGG - Intergenic
1080669672 11:34364459-34364481 CAAATACCTGTGTCAGGAATGGG - Intergenic
1080956686 11:37105392-37105414 CAAATACCTGTAAACTGCATAGG + Intergenic
1086226333 11:84514641-84514663 CAACTACCTTTCTCAGGCTTTGG - Intronic
1086969707 11:93067037-93067059 CAAATACATGTAATATGGTTTGG - Intergenic
1090533047 11:127611162-127611184 CAAATCCCTGGATGATCCTTGGG - Intergenic
1093313392 12:17619042-17619064 CAAAAATCTGAACCATGCTTCGG + Intergenic
1096255393 12:50059081-50059103 GAATGACCTGTATCATGCTGGGG + Exonic
1101208943 12:102517021-102517043 AAAATATCTCTATCATGGTTTGG + Intergenic
1105601456 13:21892071-21892093 CAAATACCCAAAACATGCTTGGG - Intergenic
1108032747 13:46253385-46253407 AAAATTCCTGTATCGTGCTCTGG - Intronic
1109443491 13:62404212-62404234 CAAATCCCAGTATTATGATTTGG - Intergenic
1110552767 13:76827071-76827093 GAACTACCTGTATCATACTTTGG - Intergenic
1112196109 13:97228051-97228073 CAACTCCCTGTAACAGGCTTAGG - Intronic
1123139422 14:106060989-106061011 CTAACACCTGTATCATGCCATGG - Intergenic
1124849446 15:33322244-33322266 CAGATGCCAGTGTCATGCTTGGG - Intronic
1127390693 15:58502915-58502937 CAAATACCTGTTGAATGATTAGG - Intronic
1128441877 15:67717722-67717744 CATATGCGTGTATGATGCTTTGG + Intronic
1129220921 15:74131213-74131235 CACATGCGTGTATCTTGCTTGGG + Exonic
1131104415 15:89722124-89722146 CACTTACCTGTAACAGGCTTAGG - Exonic
1137851235 16:51746583-51746605 CAAATATTTTTATTATGCTTGGG - Intergenic
1141002815 16:80324125-80324147 CGAATACCTGAATCATGATTGGG + Intergenic
1146594328 17:34156199-34156221 CAATGACCTGTACCATGCTGGGG - Intronic
1146694742 17:34899904-34899926 CAAATACCTGTAACACACTGAGG + Intergenic
1147710592 17:42461229-42461251 CAATTACCTGGAGAATGCTTAGG - Intronic
1150319518 17:64200805-64200827 CAAATTCCTTTATTCTGCTTGGG + Intronic
1153087566 18:1305806-1305828 CAAATCCTTGTCTGATGCTTGGG - Intergenic
1153254917 18:3160977-3160999 CAAAAACCTTTGTCATGCTATGG - Intronic
1159673307 18:71250311-71250333 CAACTAACTGTATCAAGTTTGGG + Intergenic
1165177970 19:33943825-33943847 CAAATATCTGTACCAGGCTGTGG - Intergenic
1165547275 19:36551036-36551058 CAAAGACCTGAATCATGATCTGG + Intronic
925652690 2:6108309-6108331 CAAAAACATGTATCATTCTGTGG + Intergenic
928774450 2:34742553-34742575 CAAATAGCTGTATTGTGATTTGG - Intergenic
930607571 2:53508395-53508417 CAAATTCCTTTATCATCCATGGG - Intergenic
933030687 2:77325210-77325232 CAAATCCCTGTATCAGCCTCTGG + Intronic
933765384 2:85705012-85705034 TAAATAACAGTATCAAGCTTGGG - Intergenic
935200025 2:100848327-100848349 GAGATTCCTGTATCATACTTGGG + Intronic
939599953 2:144176392-144176414 CAAAAGCCAGTATCATACTTGGG + Intronic
940660621 2:156540490-156540512 CAGATAACTGTCTCATGTTTTGG - Intronic
941448090 2:165626533-165626555 CAAATATTTATCTCATGCTTTGG - Intronic
941622314 2:167792133-167792155 ATAATACCTGTATCATGATCAGG - Intergenic
944087499 2:195866546-195866568 AATATACTTGTTTCATGCTTAGG - Intronic
944268795 2:197758863-197758885 CCAATACCTGTATCTTACTTGGG + Intronic
945210409 2:207376577-207376599 CAAATACCTGATGCATGCATGGG - Intergenic
945792824 2:214326606-214326628 CAAATACCTCTATCATGCTGGGG - Intronic
946479292 2:220038492-220038514 CAAATTCCTGTATCATCCTTAGG - Intergenic
947170316 2:227304193-227304215 AAAATACCTGTAAACTGCTTTGG + Intronic
947980110 2:234401493-234401515 CAAGTATCTGTAGCATGCTCTGG + Intergenic
1174201977 20:48812932-48812954 CAAATAGCTGTTTCATCTTTGGG - Intronic
1178546789 21:33499328-33499350 CAAATACCTCTATCCACCTTAGG + Intergenic
1178711724 21:34923111-34923133 GACATAACTGTATCATGCTAAGG - Intronic
1179039620 21:37790850-37790872 CAAACACCAGTATGATCCTTTGG - Intronic
1179274743 21:39881921-39881943 CACATAGCTGTAACATGCTTGGG + Intronic
1179916959 21:44483838-44483860 CAGAAACCTGTAACATGCTGTGG - Intergenic
1182253010 22:29016812-29016834 CAAGCACCTGTAGCATGCTAGGG + Intronic
952796329 3:37242650-37242672 CAAAAACCTTTATCAGGCCTTGG - Intergenic
955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG + Intronic
958101532 3:89018281-89018303 CAAATACCTGCATTTTACTTTGG - Intergenic
960041579 3:113155371-113155393 CCAATACCTGTGTCTTGTTTTGG - Intergenic
961229513 3:125290864-125290886 GAAATAACTGCATCAGGCTTTGG + Intronic
967666911 3:192183578-192183600 CATTTACCTGTATCATGTTTTGG + Intronic
972590490 4:40481535-40481557 CAAAGACCTGGATCATGATGTGG + Intronic
972600321 4:40566292-40566314 AAAAGCCCTGTATCATGCTGGGG + Intronic
972727171 4:41755043-41755065 CCAATCCCTCTATCATACTTTGG + Intergenic
972929604 4:44055429-44055451 TAACTACCTGTATCAGGGTTAGG + Intergenic
973056835 4:45670621-45670643 AAAATACCATTATGATGCTTTGG + Intergenic
974917121 4:68192712-68192734 CAAATAACTGAATGATGCATTGG - Intergenic
974945463 4:68522370-68522392 CAAATAGCTGAAGCATGCCTGGG - Intergenic
975244114 4:72098702-72098724 CAGATCCCTGTGTCATGGTTCGG - Intronic
977791491 4:101109474-101109496 CAAATTCCTGAACCATTCTTTGG - Intronic
980288313 4:130810062-130810084 CTAATAAATGTATCATGCTAAGG + Intergenic
981333712 4:143542561-143542583 TAAATACTTGTATCATGGTTTGG - Intronic
981825367 4:148934576-148934598 CAAAAACCTGTTCCATTCTTAGG + Intergenic
981959951 4:150524533-150524555 AAAATTCCTGAATGATGCTTGGG - Intronic
987028259 5:13950272-13950294 AAAATACAAGTATCATGGTTTGG - Intergenic
987217752 5:15755569-15755591 CAAATAGCTATATTTTGCTTGGG + Intronic
988057386 5:26116174-26116196 CAAATAACAATATCATGCATTGG + Intergenic
988219427 5:28323491-28323513 CAAATAGTTGTACCATTCTTAGG + Intergenic
989017883 5:36961076-36961098 CATATACATCTCTCATGCTTGGG - Intronic
990971812 5:61515688-61515710 CAAATACCTGAATACTGCTATGG - Intronic
992435710 5:76754309-76754331 CAGATACCTTTAACATGGTTGGG + Intergenic
992453676 5:76896055-76896077 AAAATAACTGTATAATGGTTGGG - Intronic
993035905 5:82757056-82757078 CAAATAGCTTTCTCATGTTTTGG - Intergenic
993828822 5:92727714-92727736 CATCTACTTGTATCAGGCTTAGG - Intergenic
994253394 5:97563695-97563717 AAAAGGCCTATATCATGCTTAGG - Intergenic
1004484933 6:16057509-16057531 CAAATGCATGCCTCATGCTTGGG - Intergenic
1008035054 6:46736347-46736369 CAAATACATGTGAAATGCTTGGG + Intergenic
1012179640 6:96136624-96136646 GAAAGACTTATATCATGCTTAGG + Intronic
1013878162 6:114859756-114859778 CAAATACCAGCATCATAATTTGG - Intergenic
1014826319 6:126051984-126052006 CAAATATATATATCATGCTGGGG - Intergenic
1016702397 6:147068290-147068312 TAATGACCTGTAGCATGCTTTGG + Intergenic
1016742745 6:147545890-147545912 CAAATTCCTGTGTAATGCTTGGG + Intronic
1017029138 6:150205531-150205553 AAAATATATATATCATGCTTGGG + Intronic
1017546743 6:155460165-155460187 CAAAAACATATTTCATGCTTAGG - Intergenic
1022468536 7:30667180-30667202 CAAATACCTGTGTGAGGCCTGGG + Intronic
1024168232 7:46756481-46756503 CAAAGACATGAATCATCCTTGGG + Intronic
1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG + Intergenic
1029026435 7:97421726-97421748 CTAATTCCTGTATCAGGCCTGGG - Intergenic
1034375826 7:150643060-150643082 CAAATACATGTACCAGCCTTGGG + Intergenic
1035829293 8:2676908-2676930 CAAATACCTGTGGCCTGCTGTGG - Intergenic
1036106218 8:5843626-5843648 CAAATAATTGTATGAAGCTTCGG + Intergenic
1038911590 8:31970802-31970824 CAAATACCGGAAGCATGGTTTGG + Intronic
1040747103 8:50658125-50658147 GAAATAACTGCATTATGCTTTGG + Intronic
1044204316 8:89474515-89474537 CAAATACCTGTATCACTTCTGGG - Intergenic
1044628123 8:94254504-94254526 CAATTACCTGTATTAAGCCTGGG + Intronic
1050754725 9:8988085-8988107 CATATACCTGTACTATTCTTGGG - Intronic
1054705529 9:68457353-68457375 CAAATACCTGTTCCTTGCTATGG - Intronic
1057241433 9:93414574-93414596 CAAATGCCAGCACCATGCTTTGG + Intergenic
1057339128 9:94183367-94183389 CACCTGCCTGCATCATGCTTAGG + Intergenic
1057577658 9:96256235-96256257 CAAATTTCTGTGTCATCCTTGGG + Intronic
1058225540 9:102357200-102357222 CAAATACTTATAAAATGCTTTGG + Intergenic
1058392080 9:104507006-104507028 CAAATAACAGCATCATGCTGTGG - Intergenic
1058536675 9:105967873-105967895 CATATACCTTGATCATTCTTCGG + Intergenic
1060741848 9:126103956-126103978 CAAATATCTGTATGCTGCCTGGG - Intergenic
1060942944 9:127553771-127553793 CAATTAGCTGGATCATGCTACGG - Intronic
1061245168 9:129397940-129397962 CTAATACCTGTAGAATACTTAGG + Intergenic
1061998366 9:134201177-134201199 CCAAAACCTGTAAAATGCTTAGG + Intergenic
1191930301 X:66365016-66365038 CAAATATCCATGTCATGCTTGGG + Intergenic
1192757589 X:74062738-74062760 CAAGTACCTGTAAGGTGCTTTGG - Intergenic
1193910474 X:87300268-87300290 CAACTTCCTGTATCCTGCATAGG + Intergenic