ID: 955107161

View in Genome Browser
Species Human (GRCh38)
Location 3:55909268-55909290
Sequence GAACATTCCTTGGCCACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955107161 Original CRISPR GAACATTCCTTGGCCACATC AGG Intronic
903027965 1:20443044-20443066 GGGCAGTCATTGGCCACATCTGG - Intergenic
907934587 1:59030997-59031019 GCACATTCTTTGGCCACACCTGG + Intergenic
908124228 1:61014307-61014329 GAGCATTCTTTGGCCACAACCGG + Intronic
910090150 1:83452379-83452401 GAATATTCTTTGACCACAGCAGG + Intergenic
915417654 1:155754454-155754476 GCACAGTCCTTGGCCCCATCTGG + Exonic
918140814 1:181717928-181717950 GGACATTCGGTGGCCACATCAGG - Intronic
918381545 1:183960683-183960705 GAGCAATCCTGGGCCACATGTGG - Intronic
924768154 1:247053300-247053322 GAACTTTCCTGGGCAAAATCTGG - Intronic
1072309528 10:94141247-94141269 TCACATTCCTTGGTCACAACTGG - Intronic
1072824885 10:98597279-98597301 AAACATTCCTTATCCAAATCTGG - Intronic
1078114724 11:8434948-8434970 GAACATTACCTGGCCACAGCAGG - Intronic
1078139446 11:8681729-8681751 AAACAGTCCTTGACCACATAAGG + Intergenic
1081824573 11:46036394-46036416 AAAGTTTCCTTGGCTACATCTGG + Intronic
1083298657 11:61728686-61728708 GGACATTCCTGGCCCACAGCAGG - Intronic
1085482092 11:76831067-76831089 AAGCACTCCTTGGCCTCATCAGG + Intergenic
1088403462 11:109446067-109446089 AAACATTTATTGGCCACATTGGG + Intergenic
1089507338 11:118972310-118972332 GAACATTCCAAGGCCTCTTCTGG + Intronic
1093594795 12:20947502-20947524 GAACATTCCTTTGAGACATCAGG + Intergenic
1097765725 12:63524610-63524632 CAACATTCTTTGGTTACATCTGG + Intergenic
1108456245 13:50616944-50616966 AAGCATTTCTTGGCCACATCAGG + Intronic
1110408761 13:75180783-75180805 GAGCATTCCTTGTACACTTCAGG - Intergenic
1112254364 13:97816029-97816051 GAATATGCCCTGGCCTCATCAGG - Intergenic
1120293713 14:82610966-82610988 GGAGATTACTTGGACACATCTGG - Intergenic
1121578833 14:95011113-95011135 AAACATTCCTTGGGCGCCTCGGG - Intergenic
1121744352 14:96276451-96276473 GAAAATAACTGGGCCACATCTGG + Exonic
1122339532 14:101019183-101019205 CACCATGCCTTGTCCACATCTGG + Intergenic
1123019534 14:105391228-105391250 GAGCCATCCTCGGCCACATCAGG + Exonic
1124943460 15:34240243-34240265 CAAGATTCCTTTGCCACTTCTGG - Intronic
1127476153 15:59335436-59335458 GATGATTCTGTGGCCACATCAGG + Intronic
1128090712 15:64916983-64917005 GGATAATCCTTGGCCACATGGGG + Intronic
1133153408 16:3854119-3854141 GAACGTTCCCTGGCCACAGGAGG + Intronic
1133454632 16:5931357-5931379 TAACATCACTTGGCCATATCTGG + Intergenic
1134229416 16:12417422-12417444 GGACATTCCTGTGGCACATCAGG + Intronic
1135376842 16:21954361-21954383 GAACATTCCATGCCCAGGTCTGG - Intronic
1140023289 16:71260190-71260212 GAGCCTTCTTTGGCCACAGCAGG - Intergenic
1140038169 16:71387020-71387042 CAACATTCCTTGGATACATACGG - Intronic
1141645258 16:85364095-85364117 GAACAGGCCCTGCCCACATCGGG - Intergenic
1141841251 16:86575746-86575768 GAACATTCAGTGTCCCCATCTGG + Intergenic
1145442441 17:23125694-23125716 GATCATTCCTTTTCCACCTCAGG - Intergenic
1145451663 17:23256682-23256704 GAACATTCCTTTGACAGTTCAGG + Intergenic
1145622182 17:25737960-25737982 GAACATTCCTTTGACAGTTCAGG + Intergenic
1145805132 17:27721386-27721408 AAGGATTCCTAGGCCACATCTGG - Intergenic
1146153310 17:30496523-30496545 AAGGATTCCTAGGCCACATCTGG - Intronic
1146874186 17:36394989-36395011 AAGGATTCCTAGGCCACATCTGG - Intronic
1146881539 17:36445901-36445923 AAGGATTCCTAGGCCACATCTGG - Intergenic
1147065201 17:37917883-37917905 AAGGATTCCTAGGCCACATCTGG + Intergenic
1155860293 18:30889549-30889571 AACCATACCATGGCCACATCTGG - Intergenic
1158178465 18:54685027-54685049 GGAAATTCCTTTGCCACTTCAGG - Intergenic
1158237528 18:55335019-55335041 GAGCATTCAGTGGCCAAATCTGG - Intronic
1161571059 19:5031118-5031140 GAACACTACATGGCCACATCTGG + Intronic
1163955483 19:20634325-20634347 GAACACTCCTCGACAACATCAGG + Intronic
929603298 2:43218327-43218349 GAACTTTCCAAGGCCACAGCTGG + Intergenic
932705762 2:74023620-74023642 GAGCCTAGCTTGGCCACATCTGG + Intronic
933789577 2:85873097-85873119 CAACATTCAGTGGCCACAGCAGG - Intronic
934969493 2:98751370-98751392 GAACAGCCCTTGGAGACATCAGG - Intergenic
936815637 2:116456946-116456968 CAAACTTCCTTGGCCACAGCTGG - Intergenic
938626288 2:133112898-133112920 GAAGATTCCATGCACACATCTGG - Intronic
938678231 2:133660858-133660880 GAACTTTCCTTGGCACCTTCTGG + Intergenic
1170518929 20:17162965-17162987 GAAAAGTACTTGGCCAGATCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175340681 20:58227483-58227505 GAACAAACCTTGACCACCTCAGG - Intronic
1177546548 21:22565897-22565919 TAACATTCAGTGGCCACATATGG - Intergenic
1177952994 21:27561838-27561860 CAACATTCTTAGACCACATCTGG - Intergenic
1181460578 22:23083673-23083695 GCACCTTCCCTGACCACATCTGG - Intronic
949395923 3:3614680-3614702 GAAGATGCCCTGGCCACATGTGG - Intergenic
949900676 3:8812456-8812478 GACCATTGCTTGCCCAAATCCGG - Intronic
951453691 3:22867418-22867440 GAAGATTCCTTGCCCACAGTTGG - Intergenic
952095449 3:29946236-29946258 TCTCAATCCTTGGCCACATCAGG + Intronic
955107161 3:55909268-55909290 GAACATTCCTTGGCCACATCAGG + Intronic
955869396 3:63421078-63421100 GACCATTCCTGGGCAACATAGGG - Intronic
957038443 3:75316625-75316647 GAATTTCCCTTGGGCACATCAGG + Intergenic
962953116 3:140239076-140239098 CAGCAATCTTTGGCCACATCTGG + Intronic
967905257 3:194494215-194494237 GGACCTTCCTCAGCCACATCTGG + Exonic
968950241 4:3687743-3687765 GTGCATTCCGGGGCCACATCTGG + Intergenic
971174149 4:24264594-24264616 GAACCTTCATTGGCAACATGCGG + Intergenic
971210910 4:24615542-24615564 GAACATTCTTAGGCCACCTGTGG + Intergenic
974019776 4:56682544-56682566 GACCATTCTATGGCCAAATCTGG + Intergenic
974054463 4:56971544-56971566 GTACTTTTCTTGGCCTCATCAGG - Intronic
977535199 4:98249363-98249385 AACCATTACTTGGCCACATCAGG + Intergenic
979352992 4:119667870-119667892 TAACTTTCAATGGCCACATCAGG - Intergenic
981332333 4:143526337-143526359 AAACATTCCTGGGCCTCATATGG + Exonic
986815617 5:11406275-11406297 TGACAGTCCTTGGGCACATCTGG + Intronic
991616656 5:68503742-68503764 GGACATTCTTTGGCTGCATCTGG + Intergenic
993035815 5:82756072-82756094 CAACTTTGCTTGGCCAGATCAGG - Intergenic
1000322655 5:160147135-160147157 GGCCTTGCCTTGGCCACATCAGG - Intergenic
1001785150 5:174405388-174405410 GGACATGCCTGGGCCACACCAGG - Intergenic
1002350345 5:178578679-178578701 AAAAATTCCGTGGCTACATCAGG + Intronic
1004380029 6:15124748-15124770 AAGCATTCCTGGGCCACATGCGG + Intergenic
1007136835 6:39530557-39530579 TAACCTTCCTTGGCCATGTCAGG + Intronic
1007259566 6:40554145-40554167 GAACATTCCTCTCCCACTTCGGG - Intronic
1007341715 6:41194795-41194817 GAACATTCCTTTCACACATCTGG - Exonic
1018690608 6:166341464-166341486 AAAAATTCATTGGCCACATGTGG + Intronic
1024587614 7:50855224-50855246 GCACATTCTTGGGACACATCAGG + Intergenic
1025637138 7:63332361-63332383 GAACTTTCCTTGGGGACATATGG + Intergenic
1025645557 7:63415741-63415763 GAACTTTCCTTGGGGACATATGG - Intergenic
1027306999 7:76908825-76908847 GAATATTCTTTGACCACAGCAGG + Intergenic
1034308542 7:150067164-150067186 GAACATTCCTTGACCAGGTTAGG + Intergenic
1034364969 7:150538342-150538364 GAAGATTCCTTGGCCAGGTGCGG - Intergenic
1034798316 7:154033510-154033532 GAACATTCCTTGACCAGGTTAGG - Intronic
1036690548 8:10941935-10941957 GAACAGTTCTTGGCCACAAAGGG - Intronic
1037143522 8:15546235-15546257 GATCCTTCCTTCGCCACATCTGG + Intronic
1042381636 8:68121740-68121762 GAACAGTGGTTGGCAACATCTGG + Intronic
1043228536 8:77768069-77768091 GAACATACCTTGGTAACATAAGG + Intergenic
1045412428 8:101932154-101932176 GAACATGCCCTGGACACAACTGG - Intronic
1047225314 8:122951628-122951650 CAACTGTCCTTGGCCACGTCAGG - Exonic
1051350821 9:16196517-16196539 GACCTTTCTTTGGCCACAACTGG - Intergenic
1196627135 X:117889441-117889463 GAAGATTTGTTGGCCAGATCTGG - Intergenic